Sodium phosphate dibasic dihydrate

Manufactured by Merck Group

Sourced in United States, Germany, Denmark

Sodium phosphate dibasic dihydrate is a chemical compound with the formula Na₂HPO₄·2H₂O. It is a white, crystalline powder that is soluble in water. The compound is used as a buffer, pH adjuster, and source of phosphate ions in various applications.

Automatically generated - may contain errors

Lab products found in correlation

Sodium hydroxide (naoh), by Merck Group (14 mentions) Sodium phosphate monobasic dihydrate, by Merck Group (14 mentions) Sodium chloride (nacl), by Merck Group (12 mentions) Sodium phosphate monobasic, by Merck Group (10 mentions) Hydrochloric acid (hcl), by Merck Group (8 mentions) Acetonitrile, by Merck Group (8 mentions) Sodium phosphate monobasic monohydrate, by Merck Group (8 mentions) Potassium phosphate monobasic, by Merck Group (7 mentions) Methanol, by Merck Group (7 mentions) Acetic acid, by Merck Group (6 mentions) Formic acid, by Merck Group (6 mentions) Potassium chloride (kcl), by Merck Group (6 mentions) Sodium azide, by Merck Group (5 mentions) Milli q system, by Merck Group (4 mentions) Sodium citrate tribasic dihydrate, by Merck Group (4 mentions) Sodium acetate, by Merck Group (3 mentions) Deuterium oxide, by Merck Group (3 mentions) Sodium carbonate, by Merck Group (3 mentions) Urea, by Merck Group (3 mentions) Lactic acid, by Merck Group (3 mentions)

64 protocols using sodium phosphate dibasic dihydrate

Solubility and Permeability Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Atazanavir and lopinavir were purchased from
ChemShuttle (Wuxi, China), and clotrimazole was purchased from Sigma
Aldrich (St. Louis, MO). Sodium phosphate monobasic monohydrate, sodium
phosphate dibasic dihydrate, and bovine serum albumin (BSA) were purchased
from Sigma-Aldrich (St. Louis, MO). Soy PC (l-α-phosphatidylcholine,
95%) was purchased from Avanti Polar Lipids (Alabaster, AL). High-performance
liquid chromatography (HPLC)-grade solvents including methanol and
dimethyl sulfoxide (DMSO) were purchased from Alfa Aesar (Ward Hills,
MA), whereas HPLC-grade acetonitrile and n-dodecane
were purchased from Sigma Aldrich (St. Louis, MO). Hydroxypropyl methylcellulose
acetate succinate (HPMCAS) HF grade was a generous gift from Shin-Etsu
(Tokyo, Japan). Reverse osmosis water with a resistivity value of
18 MΩ or higher was used. All other chemicals were purchased
from Sigma Aldrich (St. Louis, MO).
Sodium phosphate buffer
solutions of pH 6.5 with an ionic strength of 50 mM were prepared
by dissolving 4.434 g of Sodium phosphate monobasic monohydrate and
3.186 g of sodium phosphate dibasic dihydrate in 1 L of water.

Narula A., Sabra R, & Li N. (2022). Mechanisms and Extent of Enhanced Passive Permeation by Colloidal Drug Particles. Molecular Pharmaceutics, 19(9), 3085-3099.

+ Open protocol

+ Expand

Mass Spectrometry Sample Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ammonium bicarbonate (ABC),
ethanol (EtOH),
sodium bicarbonate (NaHCO₃), sodium chloride (NaCl), sodium
hydroxide (NaOH), sodium phosphate dibasic dihydrate (Na₂HPO₄·2H₂O), and monopotassium phosphate
(KH₂PO₄) were obtained from Merck (Darmstadt,
Germany). Glacial acetic acid, DL-dithiothreitol (DTT), hydrochloric
acid (HCl), and iodoacetamide were acquired from Sigma-Aldrich (Steinheim,
Germany). Ammonium acetate, formic acid (FA), and water of LC-MS grade
water were purchased from Fluka (Steinheim, Germany). Trypsin from
bovine pancreas was obtained from Promega (Madison, WI). Milli-Q water
(MQ) was obtained using a Q-Gard 2 system (Millipore, Amsterdam, The
Netherlands). HPLC supraGradient acetonitrile (MeCN) was acquired
from Biosolve (Valkenswaard, The Netherlands). PSA standard derived
from semen was purchased from Lee BioSolutions (St. Louis, MO). Five
times concentrated (5×) PBS consisted of 0.16 M Na₂HPO₄, 0.02 M KH₂PO₄, 0.73 M NaCl
at pH 7.2. Next, 1× PBS was prepared from the 5× PBS by
diluting it with MQ and resulting in a pH of 7.6.

Kammeijer G.S., Nouta J., de la Rosette J.J., de Reijke T.M, & Wuhrer M. (2018). An In-Depth Glycosylation Assay for Urinary Prostate-Specific Antigen. Analytical Chemistry, 90(7), 4414-4421.

+ Open protocol

+ Expand

Determination of Folate Vitamers in Biological Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following chemicals were obtained commercially from the sources given in parentheses: rat serum (Biozol, Eching, Germany), chicken pancreas (Difco, Sparks, MD, USA), acetic acid, acetonitrile, sodium phosphate dibasic dihydrate, formic acid, hexane, methanol, potassium phosphate monobasic, sodium hydroxide, sodium chloride (Merck, Darmstadt, Germany), alpha-amylase, ammonium formate, ascorbic acid, pteroylmonoglutamic acid, 4-morpholineethanesulfonic acid (MES), 2-mercaptoethanol, protease type XIV, sodium acetate (Sigma, Deisenhofen, Germany), (6S)-tetrahydrofolic acid, calcium (6S)-5-methyltetrahydrofolate, 10-formylfolic acid, and (6S)-5-formyltetrahydrofolic acid (Schircks, Jona, Switzerland). All chemicals were at least of analytical-reagent grade. [²H₄]-5-methyltetrahydrofolic acid, [²H₄]-5-formyltetrahydrofolic acid, [²H₄]-tetrahydrofolic acid, [²H₄]-10-formylfolic acid, and [²H₄]-pteroylmonoglutamic acid were synthesized as previously reported (14 (link)).

Mönch S., Netzel M., Netzel G., Ott U., Frank T, & Rychlik M. (2016). Pilot Study on Folate Bioavailability from a Camembert Cheese Reveals Contradictory Findings to Recent Results from a Human Short-term Study. Frontiers in Nutrition, 3, 9.

+ Open protocol

+ Expand

Electrochemical Biosensor for SARS-CoV-2 Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sodium phosphate dibasic dihydrate (Na₂HPO₄·2H₂O), sodium phosphate monobasic monohydrate (NaH₂PO₄·H₂O), sodium chloride (NaCl), sulfuric acid (H₂SO₄), sodium thiosulphate (Na₂S₂O₃), tetrachloroauric acid (HAuCl₄), double stranded calf thymus DNA activated and lyophilized (dsDNA), DNA oligonucleotides (listed in Tables 1) and 1,4-Dithiothreitol (DTT) and [Ru(bpy)₃]Cl₂·6H₂O were purchased from Merck (www.merckgroup.com/es-es). Tiger nut milk was used as a natural precursor for the CDs preparation. Purified water Millipore Milli-Q-System (18.2 MΩ cm) was used for solutions preparation.Table 1

SARS-CoV-2 ORF1ab DNA sequences used in this work.

Table 1

	SARS-CoV-2 ORF1ab oligonucleotides	Named
Thiol- probe	5′- SH-C₆H₁₀-CCATAACCTTTCCACATACCGCAGACGG -3′	ProbeORF-SH
Thiol- probe TAMRA	5′- SH-C₆H₁₀-CCATAACCTTTCCACATACCGCAGACGG -TAMRA-3′	ProbeORF_TAMRA-SH
Complementary	5′- CCGTCTGCGGTATGTGGAAAGGTTATGG -3′	SARS-CoV-2_C
Non-Complementary	5′- GACCGTCGAAGTAAAGGGTTCCATA -3′	SARS-CoV-2_NC
Mutated	5′- CCGTCTGCGGTATCTGGAAAGGTTATGG -3′	SARS-CoV-2_SM
Interferent	5′-C CAGGT GGAAC ATCAT CCGGT GATGC-3′	SARS-CoV-1
Interferent	5′-TTAGTCATCTGCGGGAATGCAGCATTATCT-3′	Influenza A

Gutiérrez-Gálvez L., del Caño R., Menéndez-Luque I., García-Nieto D., Rodríguez-Peña M., Luna M., Pineda T., Pariente F., García-Mendiola T, & Lorenzo E. (2022). Electrochemiluminescent nanostructured DNA biosensor for SARS-CoV-2 detection. Talanta, 240, 123203.

+ Open protocol

+ Expand

Preparation of NMR Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

All solvents and reagents were analytical grade, sodium phosphate dibasic dihydrate, sodium azide, deuterium oxide, 3-(Trimethylsilyl) propionic-2,2,3,3-d₄ acid sodium salt (TSP-d₄) and 3-(Trimethylsilyl)-1-propanesulfonic acid-d₆ sodium salt (DSS-d₆) were supplied by Merck (Germany). The ultrapure water was obtained in a Milli-Q purification system of Merck Millipore. The Vivaspin^® 500 3000 K MWCO Centrifugal Concentrators were provided by Sartorius.

Gómez-Archila L.G., Palomino-Schätzlein M., Zapata-Builes W., Rugeles M.T, & Galeano E. (2023). Plasma metabolomics by nuclear magnetic resonance reveals biomarkers and metabolic pathways associated with the control of HIV-1 infection/progression. Frontiers in Molecular Biosciences, 10, 1204273.

+ Open protocol

+ Expand

Optimizing Lipid-Lowering Drug Formulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rosuvastatin calcium (RVT), Kollicoat® IR (KIR) and Kollidon® 90F (KF90) were purchased from BASF, Germany. Sodium dihydrogen phosphate, sodium phosphate dibasic dihydrate, methanol, sodium hydroxide were bought from Merck, Germany. Other chemical agents and distilled water were collected and prepared from the Biopharmaceutics laboratory, Department of Pharmaceutical Technology, University of Dhaka, Bangladesh.

Sikdar K.Y.K., Nazir M., Alam M.M., Sarkar M.R., & Rahman S.A.R. (2021). Evaluation of in vitro Dissolution Profile and Physicochemical Characterization of Polymer Based Formulations of Sparingly Soluble Rosuvastatin. Dhaka University Journal of Pharmaceutical Sciences, 20(2), 199-211.

+ Open protocol

+ Expand

Bacterial Cell Preparation for Microscopy and Rheology

Check if the same lab product or an alternative is used in the 5 most similar protocols

For microscopy, rheology and tensiometry assays, the bacteria were suspended in buffer solutions. As standard buffer, a phosphate buffer comprising sodium phosphate monobasic dihydrate (Sigma-Aldrich) and sodium phosphate dibasic dihydrate (Sigma-Aldrich) at pH 7 and an ionic strength of 100 mM was used. All buffer solutions were made using bidistilled water and autoclaved at 121°C for 15 minutes. As oil phase, mineral oil (Sigma-Aldrich, 330779) was used for all experiments.
For the bacterial adhesion tests, tensiometry, microscopy, determination of the Zeta potential and the BATH-Test, the suspended cells from the measuring cultures, were centrifuged (Biofuge pico, Heraeus and Biofuge primo, Heraeus) and resuspended in buffer solution three times and diluted using buffer solution until OD₆₀₀ = 0.6 was reached (BIO Photometer, Vaudaux-Eppendorf).

de Wouters T., Jans C., Niederberger T., Fischer P, & Rühs P.A. (2015). Adhesion Potential of Intestinal Microbes Predicted by Physico-Chemical Characterization Methods. PLoS ONE, 10(8), e0136437.

+ Open protocol

+ Expand

Analytical Method for Ochratoxin A

Check if the same lab product or an alternative is used in the 5 most similar protocols

All solvents and reagents were analytical grade or HPLC grade. The OTA standard and the U-[ 13 C 20 ]-OTA standard (internal standard, IS) used to prepare standard solutions for the validation of the applied methodology were purchased from Biopure (Tulln, Austria). Ochraprep® immunoaffinity columns from R-Biopharm AG (Darmstadt, Germany) were used for samples purification. Acetonitrile, acetic acid, sodium phosphate dibasic dihydrate, potassium dihydrogen phosphate anhydrous, potassium chloride and sodium carbonate were purchased from Sigma-Aldrich Co. (St Louis, MO, USA); sodium chloride and sodium sulphate anhydrous were obtained from Panreac (Barcelona, Spain); sodium hydroxide, methanol, and formic acid were purchased from Merck KGaA (Darmstadt, Germany), WWR Chemicals (Milano, Italy), and Carlo Erba Reagents (Cornaredo, MI, Italy), respectively. Ultrapure water used throughout the experiments was produced by a Millipore Milli-Q system (Millipore, Bedford, MA, USA).

Roncada P., Altafini A., Fedrizzi G., Guerrini A., Polonini G., & Caprai E. (2020). Ochratoxin A contamination of the casing and the edible portion of artisan salamis produced in two Italian regions. World Mycotoxin Journal, 13(4), 553-562.

+ Open protocol

+ Expand

Purification and Characterization of MWCNTs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Multi-walled carbon nanotubes 95% o.d., L 6 -9 nm × 5 μm (MWCNT), sodium phosphate dibasic dihydrate, 4-acetaminophenol (ACOP), poly(4-lithium styrenesulfonic acid) (PSSLi-30 wt% solution in water), and uric acid sodium salt were obtained from Sigma-Aldrich and were stored at room temperature.
Also 3,4-ethylenedioxythiophene (EDOT), (-)epinephrine (+)-bitartrate salt and dopamine hydrochloride (Sigma-Aldrich) were stored at 4°C. Ascorbic L(+) acid, citrate acid, sulfuric acid and hydrogen peroxide were supplied by POCH Gliwice.
Multi-walled carbon nanotubes were purified before the experiment. First 1 g of MWCNT was treated in boiling concentrated nitric acid (50 mL) under a reflux condenser for 24 h. The solid product was washed several times with doubledistilled water and then centrifuged (5000 rpm, 15 min) until the suspension became neutral (pH ~7). An aqueous suspension of the nanotubes was obtained as a result. Other reagents were analytically pure and used without further purification. All the solutions were prepared with distilled water purified with a Millipore (Milli-Q) system.

Sipa K., Socha E., Skrzypek S, & Krzyczmonik P. (2017). Electrodes Modified with Composite Layers Based on Poly(3,4-ethylenedioxythiophene) as Sensors for Paracetamol. Analytical sciences : the international journal of the Japan Society for Analytical Chemistry, 33(3).

+ Open protocol

+ Expand

Buffers for Immunoassay Development

Check if the same lab product or an alternative is used in the 5 most similar protocols

All buffers were prepared in Milli-Q water and stored in amber glass bottles at room temperature (RT, 22 ± 1 °C) unless stated otherwise. The pH values were adjusted using 6 M hydrochloric acid (Merck) or 5 M sodium hydroxide solution (J.T.Baker, Phillipsburg, NJ, USA).

Phosphate-buffered saline (PBS), pH 7.6: 10 mM sodium phosphate monobasic dihydrate (Sigma-Aldrich), 70 mM sodium phosphate dibasic dihydrate (Sigma-Aldrich), 145 mM sodium chloride (Sigma-Aldrich).

Washing buffer, pH 7.6: 0.75 mM potassium phosphate monobasic (Sigma-Aldrich), 6.25 mM potassium phosphate dibasic (Sigma-Aldrich), 0.025 mM potassium sorbate (Sigma-Aldrich), 0.05% Tween 20 (Serva, Heidelberg, Germany).

Assay buffer (Tris–EDTA), pH 7.6, storage at 4 °C: 125 mM tris(hydroxymethyl)-aminomethane (Tris, Merck), 187.5 mM sodium chloride, 13.375 mM ethylenediaminetetraacetic acid disodium salt dihydrate (Na₂EDTA·2H₂O, Sigma-Aldrich).

Citrate buffer, pH 4.0, storage at 4 °C: 220 mM sodium citrate monobasic (Sigma-Aldrich).

TMB stock solution in dry N,N-dimethylacetamide (DMA, Sigma-Aldrich), storage under argon at 4 °C: 8 mM tetrabutylammonium borohydride (Sigma-Aldrich), 40 mM 3,3’,5,5’-tetramethylbenzidine (TMB, Serva).

Ecke A., Westphalen T., Hornung J., Voetz M, & Schneider R.J. (2021). A rapid magnetic bead-based immunoassay for sensitive determination of diclofenac. Analytical and Bioanalytical Chemistry, 414(4), 1563-1573.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!