Pcdna6.2 gw emgfp mir

Third generation lentivirus was generated as described previously [24] (link), [25] (link). Briefly, small microRNA-embedded hairpin RNA (miR-shRNA) constructs were generated in pcDNA6.2-GW/EmGFP-miR (Invitrogen) along with an EGFP reporter and driven by a neuron-specific synapsin promoter [24] (link). A non-targeting control microRNA embedded shRNA served as a control designated ‘scrambled’. Three different targeting regions were tested within the open reading frame of murine CREB binding protein (Crebbp, NM_001025432) i.e. AGGCAGCAGCCAGCATTGATA (CBP-miR-shRNA-1), TGTGCCCATGCTGGAAATGAA (CBP-miR-shRNA-2) or CTGCCTCAACATCAAACATAA (CBP-miR-shRNA-3). Neuronal cultures were transduced on DIV 3. After 96 h, transduction efficiencies (>95% of neurons) and multiplicity of infection (approximately 5 MOI) were determined and calculated from serial dilutions in neuronal cultures using enhanced green fluorescent protein (EGFP) fluorescence as a reporter.

Two complementary oligonucleotides were denatured and annealed into double-stranded DNAs, and then were inserted into a linearized expression vector, pcDNA6.2-GW/EmGFP-miR (Invitrogen). The pcDNA6.2-GW/EmGFP-miR vectors had the BLOCK-iT Lentiviral Pol II miR RNAi Expression Systems that were designed to express artificial pre-miRNA hairpin which were excised by Drosha when present in the nucleus. After excision, the pre-miRNA hairpin is exported to the cytoplasm for further processing by Dicer. One strand of the resulting miRNA duplex intermediate is incorporated into RISC, where it acts as a guide RNA to target RISC to fully complementary ALV-J mRNAs. This primarily results in translational inhibition and mRNA degradation. The expressed structure of miRNA-embedded siRNA is shown in Figure 1B. All recombinant plasmids were sequenced (F:5′- GGCATGGACGAGCTGTACAA -3′; R: 5′- CTCTAGATCAACCACTTTGT -3′; invitrogen) to confirm the inserted sequences are right. Each recombinant plasmid was transformed into competent cell DH5α and smeared on LB solid medium containing 50 μg/ml of spectinomycin dihydrochloride (Sigma) for amplification. The positive clones were propagated and cultured in liquid LB. The recombinant plasmids were extracted with endotoxin-free plasmid extraction kit (Sigma).

For miR specific for caspase-1 and NLRP3, target sequences were designed using Invitrogen’s RNAi Designer (http://rnaidesigner.lifetechnologies.com/rnaiexpress). The double-stranded DNA oligonucleotides were synthesized and cloned into the parental vector pcDNA6.2-GW/EmGFP-miR (Invitrogen, Carlsbad, CA). The expression cassette for miR was moved into the pENTR/CMV vector and adenovirus was made as previously reported46 (link). The miR sequences were as follows: caspase-1, top strand 5′-TGCTGAGAAAGTACTCCTTGAGAGTCGTTTTGGCCACTGACTGACGACTCTCAGAGTACTTTCT-3′ and bottom strand 5′-CCTGAGAAAGTACTCTGAGAGTCGTCAGTCAGTGGCCAAAACGACTCTCAAGGAGTACTTTCTC-3′; NLRP3, top strand 5′-TGCTGATCACAGTGGGATTCGAAACAGTTTTGGCCACTGACTGACTGTTTCGACCCACTGTGAT-3′ and bottom strand 5′-CCTGATCACAGTGGGTCGAAACAGTCAGTCAGTGGCCAAAACTGTTTCGAATCCCACTGTGATC-3′.

Mouse miR-21a-5p expression plasmid was constituted by inserting an oligonucleotide conforming to the sequence of the mmu-miR-21a-5p into a mammalian expression vector, pcDNA6.2-GW/EmGFPmiR (Invitrogen, Carlsbad, CA, USA).
Fragment (249 bp) of the mouse Sox5 3′ UTR was PCR amplified by Sox5 primers and then inserted into pmiRGL0 dual-luciferase miRNA target vector (Promega, Fitchburg, WI, USA) with Sal I and Xho I restriction sites to form the pmiRGL0-Sox5-wt-3′ UTR construct. The pmiRGL0-Sox5-mut-3′ UTR construct was created by Sox5 specially designated primers using the KOD-Plus-Mutagenesis Kit (TOYOBO CO., OSAKA, Japan) (Table 1).

BKPyV-miRNAs were inserted into the pcDNA 6.2GW/EmGFP-miR (Invitrogen, Carlsbad, CA, USA) vectors and cloned according to the manufacturer’s instructions. To this end, specific oligonucleotide pairs were designed on the BKPyV miRNA mature sequence (5′TGCTGATCTGAGACTTGGGAAGAGCATTTTTGGCCACTGACTGAATGCTCTTCCCATCTCAGAT3′ forward oligonucleotide and 5′CCTGATCTGAGATGGGAAGAGCATTCAGTCAGTGGCCAAAAATGCTCTTCCCAAGTCTCAGATC3′ reverse oligonucleotide; BKPyV-miRNA mature sequence is underlined below the sequences shown). Next, the corresponding expression vectors pcDNA6-BK-miRNA (10 µg) were transfected into Cos-7 cells (7.5 × 10⁵ cells per well in 6-well plate) using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). BKPyV-miRNA expression vectors system (encodes for the green fluorescence protein GFP) efficiency was assessed at 24h after transfection based on the number of GFP-positive cells, as determined by flow cytometry. In subsequently experiments exosomes carrying BKPyV-miRNA were purified at 24 h, 48 h and 72 h from transfected Cos-7 cells and were quantified. The sequence of the miRNA inserts was confirmed by sequencing.

The normal human pancreatic ductal epithelial cell line (HPDE6-C7) was purchased from the Beijing Beinachuanglian Biotechnology Research Institute (Beijing, China) and cultured in an appropriate density with the recommended medium, supplemented with 10% fetal bovine serum in a humidified incubator containing 5% CO₂ at 37°C.
An LSR shRNA (targeting sequences of 5′-TGCTGAGCTACTCCTGTCAACGTCTCGTTTTGGCCACTGACTGACGAGACGTTCAGGAGTAGCT-3′) was cloned into a pcDNA6.2-GW/EmGFP-miR (Invitrogen, Carlsbad, CA, USA). This expression vector used plenti6.3/V5 DEST vectors. After amplification and DNA sequencing confirmation, this vector or negative control (NC) vector was used to generate lentiviruses in HEK-293 cells. These lentiviruses were used to infect HPDE6-C7 cells and named as LSR-knockdown (LSR-KD) cells or NC cells. In addition, a lentiviral vector carrying human LSR cDNA or vector only was used to infect HPDE6-C7 cells with LSR overexpression (LSR-OE) in cells. The efficiency of LSR-KD or LSR-OE was confirmed using RT-qPCR and Western blot. Moreover, to determine the effects of LSR on HPDE6-C7 cells in the HTG environment, cells were treated with 2 mM palmitic acid (PA) (Sigma, USA) for 24 h prior to use for subsequent experiments.

For Myc-tagged AF expression plasmid, full-length rat AF (residue 1-640), N-terminal fragment AF-N (residue 1-300), and C-terminal fragment AF-C (residue 301-640) were PCR-amplified and subcloned into vector GW1-Myc2b digested by BglII and EcoRI. To generate AF-miR knockdown constructs, miRNA was designed using BLOCK-iT™ RNAi Designer (https://rnaidesigner.thermofisher.com/rnaiexpress/). According to the ranking score, the top two miRNAs (nucleotide residues 590-610 and nucleotide residues 709-729) were chosen, linked together, and cloned into pcDNA6.2-GW/EmGFP vector. Accordingly, this knockdown plasmid expresses two AF miRNAs, resulting in better knockdown efficiency. A control vector (pcDNA6.2–GW/EmGFP-miR, Invitrogen) expressing a miRNA predicted to not target any gene in mammalian genomes was used as the negative control in knockdown experiments. To generate the silent mutant resistant to AF-miR, site-directed mutagenesis was performed using the following oligonucleotide: 5′-GATTTGCTGATACGCACTCAT-3′ for nucleotide residues 590-610 and 5′-CTGGAACTTGTATCTAGTGAT-3′ for nucleotide residues 709-729, respectively. The underlined bases indicate the mutated sites. GFP-actin was purchased from Clontech and used to outline neuronal morphology.