Abi prism big dye terminator cycle sequencing ready reaction kit v 3

The extraction of genomic DNA was performed as reported previously (Voglmayr and Jaklitsch 2011 (link); Jaklitsch et al. 2012 (link)) using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). The following loci were amplified and sequenced: the complete internally transcribed spacer region (ITS1-5.8S-ITS2) and a c.900-bp fragment of the large subunit nuclear ribosomal DNA (nLSU rDNA), amplified and sequenced as a single fragment with primers V9G (de Hoog and Gerrits van den Ende 1998 (link)) and LR5 (Vilgalys and Hester 1990 (link)); a c.1.2-kb fragment of the RNA polymerase II subunit 2 (rpb2) with primers fRPB2-5f and fRPB2-7cr (Liu et al. 1999 (link)); and a c.1.3-kb fragment of the translation elongation factor 1-alpha (tef1) with primers EF1-728F (Carbone and Kohn 1999 (link)) and TEF1LLErev (Jaklitsch et al. 2005 (link)). PCR products were purified using an enzymatic PCR cleanup (Werle et al. 1994 (link)) as described in Voglmayr and Jaklitsch (2008 (link)). DNA was cycle-sequenced using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit v.3.1 (Applied Biosystems, Warrington, UK) with the same primers as in PCR. In addition, the primers ITS4 (White et al. 1990 ) and LR3 (Vilgalys and Hester 1990 (link)) were used for the ITS-28S region. Sequencing was performed with an automated DNA sequencer (3730xl Genetic Analyzer; Applied Biosystems).

All the serum samples were centrifuged within 4 hours after the blood was drawn, and the HCV viral load, genotype was tested within 1 week by HCV GT II by using Abbott RealTime HCV m2000 PCR System. The qualified samples were stored in -70°C for further HCV GT Plus testing according to the manufacturer’s manual. Direct sequencing was done on 5’ UTR region by using ABI PRISM Big-Dye Terminator Cycle Sequencing Ready Reaction Kit, v3.1 (Applied Biosystems) on the ABI PRISM 3730XL DNA Analyzer. Primers used for PCR amplification and sequencing of 5’ UTR region were TTGTGGTACTGCCTGATAGGG (forward) and GGATGTACCCCATGAGGTCG (reverse). The reverse transcription reaction was done by using High Capacity cDNA Reverse Transcription Kit according to the standard protocol of the supplier (Applied Biosystems) for 120 min at 37°C. The clinical data such as albumin, bilirubin, transaminase, gamma-glutamyl transferase (GGT), and lipids levels were measured on a multichannel auto analyzer (Hitachi Inc, Tokyo, Japan).

The extraction of genomic DNA from pure cultures was performed by using the Wizard Genomic DNA Purification Kit (Promega Corporation, WI, USA). Partial regions of six loci (ITS, LSU, and SSU rDNA, RPB2, TEF1, TUB2) were amplified; for details on the primers and annealing temperatures used for PCR and sequencing, see Table 2. The PCR products were sequenced in both directions by Macrogen Inc. (South Korea) or at the Department of Botany and Biodiversity Research, University of Vienna using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit v. 3.1 (Applied Biosystems, Warrington, UK) and an automated DNA sequencer (3730xl Genetic Analyser, Applied Biosystems). The DNA sequences generated were assembled with Lasergene SeqMan Pro (DNASTAR, Madison, USA). Sequences generated during the present study were uploaded to Genbank (Table 3).