Cut run kit

Manufactured by Cell Signaling Technology

The CUT&RUN kit is a laboratory tool designed for chromatin profiling. It utilizes a targeted approach to isolate and analyze specific regions of genomic DNA bound by proteins of interest. The kit provides the necessary components and protocols to perform this technique.

Automatically generated - may contain errors

Lab products found in correlation

Anti rabbit mab igg isotype control, by Cell Signaling Technology (2 mentions) Anti trim28, by Thermo Fisher Scientific (2 mentions) Cultrex 3d culture cell harvesting kit, by Bio-Techne (2 mentions) Anti tri methyl histone h3, by Cell Signaling Technology (2 mentions) Qiaquick pcr purification kit, by Qiagen (2 mentions) H3k27ac, by Thermo Fisher Scientific (1 mentions) Nebnext ultra 2 dna library, by New England Biolabs (1 mentions) Nextseq 2000, by Illumina (1 mentions) Gata1, by Abcam (1 mentions) Anti h3k27me3, by Cell Signaling Technology (1 mentions) Mab igg xp isotype control, by Cell Signaling Technology (1 mentions) Anti h3k27ac ab4729, by Abcam (1 mentions) Gfx pcr dna and gel band purification kit, by Cytiva (1 mentions) Simplechip universal qpcr mastermix, by Cell Signaling Technology (1 mentions) Cfx manager software, by Bio-Rad (1 mentions) Cfx connect real time system, by Bio-Rad (1 mentions) Anti h3k27me3, by Merck Group (1 mentions) Novaseq 6000, by Illumina (1 mentions) Nextseq 500, by Illumina (1 mentions) H2bub1, by Cell Signaling Technology (1 mentions)

9 protocols using cut run kit

CUT&RUN for Histone H3 and TRIM28 Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

CUT&RUN assays were performed using the CUT&RUN kit from Cell Signaling Technology (#86652) according to the manufacturer's instructions. Briefly, MDA-MB-231 cells were plated in Cultrex-coated 6-well plates at a density of 300,000 cells/well, and were harvested 5 days later using Cultrex 3D-Culture Cell Harvesting Kit (Trevigen). The resulting single-cell suspensions were collected (10⁵ cells/reaction), washed, and rotated with Concavalin A magnetic beads for 2 hours at 4°C with the following antibodies as indicated: (i) anti-trimethyl-Histone H3 (2 μL/reaction; Cell Signaling Technology #9751); (ii) anti-rabbit mAb IgG Isotype control (5 μL/reaction; Cell Signaling Technology #66362); or (iii) anti-TRIM28 (5 μL/reaction; Thermo Fisher Scientific #MA1-2023, RRID:AB_2209892). Subsequently, the reactions were rotated with pAG-MNase enzyme, which was activated by addition of CaCl₂ and incubated sequentially for 30 minutes at 4°C and 37°C. The resulting DNA fragments were purified with Qiagen QIAquick PCR purification kit (#21804). Input samples underwent DNA extraction and sonication (5 Watts, 30-second intervals for 25 cycles) before purifying DNA and performing qRT-PCR as described previously.

Parker K.A., Gooding A.J., Valadkhan S, & Schiemann W.P. (2021). lncRNA BORG:TRIM28 Complexes Drive Metastatic Progression by Inducing α6 Integrin/CD49f Expression in Breast Cancer Stem Cells. Molecular Cancer Research, 19(12), 2068-2080.

+ Open protocol

+ Expand

Grainy head ChIP-seq from Drosophila wing discs

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

100 lightly fixed imaginal wing discs were used for each sample. For Cut&Run [20 (link)], the protocol provided with the Cell Signaling Cut&Run Kit (CAT: 86652S) was used with the following minor modifications and specifications: (1) 200uL (instead of 1 mL) of 1x Wash Buffer was used to dounce homogenize the wing discs to ensure efficient pelleting, (2) the provided spike-in DNA was added at 1:100 dilution, and (3) for each sample, we used 3uL of a Grainy head antibody that targets an epitope on the C-terminus of Drosophila Grh [21 (link)]. To construct Cut&Run libraries, the NEB Ultra II Kit was used with the following modifications as described in [22 (link)], to adapt the manufacturers protocols for Cut&Run library preps of transcription factors. The fragment distribution of each sample was visualized with BioAnalyzer to confirm the presence of ~ 200-250 bp peaks representing TF-bound regions. Libraries were sequenced on Novaseq S4 300 cycle at the University of Michigan.

Ertl H.A., Hill M.S, & Wittkopp P.J. (2022). Differential Grainy head binding correlates with variation in chromatin structure and gene expression in Drosophila melanogaster. BMC Genomics, 23, 854.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation by CUT&RUN

Check if the same lab product or an alternative is used in the 5 most similar protocols

CUT&RUN was performed using the CUT&RUN Kit from Cell Signaling (catalog no. 86652S) according to the manufacturer’s instructions. Briefly, 0.2–0.8 million cells were harvested and washed twice in 1× wash buffer at room temperature and bound to 15 μl of Concanavalin A beads. Primary antibody incubation was performed in PCR tubes for 2 h at 4 °C with rotation. The following antibodies were used: H3K27ac (Invitrogen, catalog no. MA5–23516), GATA1 (Abcam, catalog no. ab11852). After two washes, pAG-MNase was added and incubated for 1 h at 4 °C with rotation. After three washes, cells were resuspended in 1× wash buffer and pAG-MNase digestion was activated by adding 2 mM CaCl₂. Samples were incubated on ice for 45 min, then 2× stop buffer was added to end the reaction. The samples were incubated at 37 °C for 10 min to release the captured chromatin fragments. The sequencing libraries were prepared using the NEBNext Ultra II DNA Library (New England Biolabs, catalog no. E7645) with 15–30 ng of input DNA. Sequencing libraries were pooled and pair-end (2 × 50 bp) sequenced on an Illumina Nextseq 2000 platform.
Reads were aligned to the reference genome using Bowtie1 with parameters --best --sam --chunkmbs 256 -X 800. Peaks were called using MACS2. Peaks overlapped with the blacklist were further filtered out using bedtools.

Huang P., Peslak S.A., Ren R., Khandros E., Qin K., Keller C.A., Giardine B., Bell H.W., Lan X., Sharma M., Horton J.R., Abdulmalik O., Chou S.T., Shi J., Crossley M., Hardison R.C., Cheng X, & Blobel G.A. (2022). HIC2 controls developmental hemoglobin switching by repressing BCL11A transcription. Nature genetics, 54(9), 1417-1426.

+ Open protocol

+ Expand

Chromatin Profiling Using CUT&RUN

Check if the same lab product or an alternative is used in the 5 most similar protocols

CUT&RUN experiments were performed in two biological replicates using the Cell Signaling Technology CUT&RUN Kit following the manufacturer's instructions. Briefly, crypts from either EPR fl/fl or EPR cKO mice proximal colon were isolated and 5 mg of lightly fixed tissue (0.1% formaldehyde for 2 min at room temperature) were used for each experimental point. Upon incubation with Concanavalin A-coated beads and with freshly dissolved digitonin, cells were incubated (16 h at 4°C under rotation) with either anti-H3K27ac (Ab4729 from Abcam), anti-H3K27me3 (#9733 Cell Signaling Technology) or negative control rabbit (DA1E) monoclonal antibody (mAb) IgG XP^® Isotype Control (Cell Signaling Technology). pAG-MNase enzyme was added and activated to digest targeted regions of the genome. DNA was purified from input and enriched chromatin samples using the GFX PCR DNA and gel band Purification kit (Cytiva), and quantified prior to being utilized in qPCRs using the primers listed in Supplementary Table S2.

Briata P., Mastracci L., Zapparoli E., Caputo L., Ferracci E., Silvestri A., Garuti A., Hamadou M.H., Inga A., Marcaccini E., Grillo F., Bucci G., Puri P.L., Beznoussenko G., Mironov A., Chiacchiera F, & Gherzi R. (2023). LncRNA EPR regulates intestinal mucus production and protects against inflammation and tumorigenesis. Nucleic Acids Research, 51(10), 5193-5209.

+ Open protocol

+ Expand

ChIP-based Profiling of β-catenin

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed using a Cut&Run kit (Cell Signaling Technology) as per the manufacturer's protocol. Briefly, 100,000 FACS-purified basal cells (Lin−; CD49f^hi; CD24+) were used per condition. Each prep was incubated with either ChIP-validated rabbit anti-CTNNB1 monoclonal antibody (active-β-catenin, Clone D13A1) or rabbit IgG Isotype control (clone DA1E) overnight at 4°C. ChIP DNA was recovered using phenol/chloroform extraction followed by ethanol precipitation as per the manufacturer's protocol. Quantification of DNA by qPCR was performed using equal amounts of DNA. qPCR analysis was performed in triplicates using SimpleChIP^® Universal qPCR Master Mix (Cell Signaling Technology, 88989). The reactions were run in a Bio-Rad CFX'Connect Real-Time System and CFX Manager software (Bio-Rad) as follows: 95°C for 3 min followed by 40 cycles of 95°C for 15 s, 60°C for 60 s. Sample normalization was performed using the signal from the Sample Normalization Spike-in yeast DNA with a primer set specific to the Saccharomyces cerevisiae ACT1 gene, provided in the Cut&Run kit.

Cazares O., Chatterjee S., Lee P., Strietzel C., Bubolz J.W., Harburg G., Howard J., Katzman S., Sanford J, & Hinck L. (2021). Alveolar progenitor differentiation and lactation depends on paracrine inhibition of notch via ROBO1/CTNNB1/JAG1. Development (Cambridge, England), 148(21), dev199940.

+ Open protocol

+ Expand

CUT&RUN Chromatin Profiling Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

500 or 15,000 EMPs were prepared for CUT&RUN using the CUT&RUN kit from Cell Signaling Technologies with Rabbit (DA1E) mAb IgG XP® isotype control (Cell Signaling Technologies) and anti-H3K27me3 (07-449, Merck MilliPore). Sequencing libraries were prepared using the NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (New England Biolabs) with 17 (500 EMPs) or 16 (15,000 EMPs) cycles of amplification. Libraries were sequenced using the Illumina NextSeq 500 (500 EMPs) and NovaSeq 6000 (15,000 EMPs) platform, generating 76 bp (500 EMPs) and 59 bp (15,000 EMPs) paired-end reads. Clones and suppliers of all antibodies used are listed in the Supplementary Table 5.

Neo W.H., Meng Y., Rodriguez-Meira A., Fadlullah M.Z., Booth C.A., Azzoni E., Thongjuea S., de Bruijn M.F., Jacobsen S.E., Mead A.J, & Lacaud G. (2021). Ezh2 is essential for the generation of functional yolk sac derived erythro-myeloid progenitors. Nature Communications, 12, 7019.

+ Open protocol

+ Expand

CUT&RUN Profiling of Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols

CUT&RUN assays were performed using the CUT&RUN kit from Cell Signaling (#86652) according to the manufacturer’s instructions. Briefly, MDA-MB-231 cells were plated in Cultrex-coated 6-well plates at a density of 300,000 cells/well, and were harvested 5 days later using Cultrex 3D-Culture Cell Harvesting Kit (Trevigen). The resulting single cell suspensions were collected (10⁵ cells/reaction), washed, and rotated with Concavalin A magnetic beads for 2 hr at 4°C with the following antibodies as indicated: (i) anti-tri-methyl-Histone H3 (2 μl/reaction; Cell Signaling #9751); (ii) anti-rabbit mAb IgG Isotype control (5 μl/reaction; Cell Signaling #66362); or (iii) anti-TRIM28 (5 μl/reaction; ThermoFisher #MA1–2023, RRID:AB_2209892). Subsequently, the reactions were rotated with pAG-MNase enzyme, which was activated by addition of CaCl₂ and incubated sequentially for 30 min at 4°C and 37°C. The resulting DNA fragments were purified with Qiagen QIAquick PCR purification kit (#21804). Input samples underwent DNA extraction and sonication (5 Watts, 30 second intervals for 25 cycles) before purifying DNA and performing qRT-PCR as described.

+ Open protocol

+ Expand

Investigating KLF14 Regulation of HK2 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

293T cells were transfected with KLF14-Flag or vector plasmid for 48 h, and then ChIP assays were performed using the CUT & RUN Kit (#86652, Cell Signaling Technology). Following the protocol, the resulting DNA products were quantified by q-PCR. The sequences of the primers for the HK2 promoter were 5’-CCCATAGCCGAGCCTGACCTGGAC-3’ and 5’ -CGCATGAGCCACCGCCGC and 5’-CTGAGATGGGACGTGTGGT-3’ and 5’ -CGTCCCAGCCTTTAGCCACGG-3’.

Yuan Y., Fan G., Liu Y., Liu L., Zhang T., Liu P., Tu Q., Zhang X., Luo S., Yao L., Chen F, & Li J. (2022). The transcription factor KLF14 regulates macrophage glycolysis and immune function by inhibiting HK2 in sepsis. Cellular and Molecular Immunology, 19(4), 504-515.

+ Open protocol

+ Expand

Bortezomib Regulates MEIS1 and CDK6 in SEM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

SEM cells were treated with 50 nM bortezomib or media for 0, 2, 4, and 6 h at 37 °C. CUTANA^TM CUT&RUN kit (EpiCypher 14-1048) was used, according to manufacturer’s instructions, to immunoprecipitate chromatin bound by MLL (Bethyl A300-086A), H2Bub1 (Cell Signaling 5546T), and normal rabbit IgG (CUTANA^TM CUT&RUN kit negative control). qPCR for MEIS1 exon 1 and CDK6 exon 1 was performed using PowerUP^TM SYBR^TM Green Master Mix (ThermoFisher A25742). Fold enrichment was calculated relative to the normal rabbit IgG control and then normalized to 0 h. MEIS1 exon1 primers: Forward GGAGCGCTTTTATGCTCAGT Reverse ATCCCTTAACGTCTCCAGCA. CDK6 exon1 primers: TTATCCTCCTCCCGTCTCCTCCT Reverse CTCGAAGCGAAGTCCTCAAC.

Kamens J.L., Nance S., Koss C., Xu B., Cotton A., Lam J.W., Garfinkle E.A., Nallagatla P., Smith A.M., Mitchell S., Ma J., Currier D., Wright W.C., Kavdia K., Pagala V.R., Kim W., Wallace L.M., Cho J.H., Fan Y., Seth A., Twarog N., Choi J.K., Obeng E.A., Hatley M.E., Metzger M.L., Inaba H., Jeha S., Rubnitz J.E., Peng J., Chen T., Shelat A.A., Guy R.K, & Gruber T.A. (2023). Proteasome inhibition targets the KMT2A transcriptional complex in acute lymphoblastic leukemia. Nature Communications, 14, 809.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!