Log In Sign up
The largest database of trusted experimental protocols

Kapa sybr fast abi prism kit

Manufactured by Roche
Visit Supplier
Sourced in United States

The KAPA SYBR FAST ABI Prism kit is a real-time PCR reagent kit designed for use with the ABI Prism platform. The kit includes a SYBR Green-based master mix, which enables rapid and sensitive detection and quantification of DNA targets.

Automatically generated - may contain errors

Lab products found in correlation

Prism 6, by GraphPad (1 mentions) Thermoscript rt pcr system, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Dnase 1, by New England Biolabs (1 mentions) Iscript reverse transcription supermix, by Bio-Rad (1 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions) Tri reagent, by Merck Group (1 mentions) Abi prism 7500 system, by Thermo Fisher Scientific (1 mentions) Dnase 1 treatment, by Qiagen (1 mentions) Rneasy plant mini kit, by Qiagen (1 mentions)

Spelling variants of this product

KAPA SYBR FAST (88 citations) KAPA SYBR FAST ABI Prism qPCR Kit (25 citations) KAPA SYBR FAST qPCR Kit Master Mix ABI Prism (10 citations) KAPA SYBR FAST ABI Prism (7 citations) KAPA SYBR FAST ABI Prism Library Quantification Kit (7 citations) KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI Prism (7 citations) KAPA SYBR FAST qPCR Kit Master Mix (2×) ABI PRISM (2 citations)

4 protocols using kapa sybr fast abi prism kit

1

Quantification of Schistosoma mansoni Sugar Transporter Expression

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from the different stages of S. mansoni with TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. Complementary DNAs (cDNA) were obtained by reverse transcription of total RNA using the Thermoscript RT-PCR System (Invitrogen, Carlsbad, USA). The cDNAs were then used as templates in triplicate assays for RT-PCR amplification using the KAPA SYBR FAST ABI Prism kit (Kapa Biosystems, Boston, USA), and ABI PRISM 7000 sequence detection system. We used previously reported primers for S. mansoni sgtp1 and sgtp4 [5 (link)]. The primers for sgtp2 and sgtp3 were designed for this study: sgtp2F 5’ TTTACCTTCGAGGGCAAGAT 3’ and sgtp2R 5’ CACCGCAAGTATGGAATACG 3’, sgtp3F 5’ GCAGCAACTCTCAGGAATCA 3’ and sgtp3R 5’ACACAATAACCGCTCCAACC 3’. The ratios of relative expression were calculated using the 2-ΔΔCt ratio [46 (link)] with S. mansoni α-tubulin as the endogenous control gene [47 (link)]. The statistical significance between groups was evaluated using the unpaired non-parametric Mann Whitney’s test in the GraphPad 6 Prism program (GraphPad Software Inc.). Differences were considered significant when p-value <0.05.
Cabezas-Cruz A., Valdés J.J., Lancelot J, & Pierce R.J. (2015). Fast evolutionary rates associated with functional loss in class I glucose transporters of Schistosoma mansoni. BMC Genomics, 16, 980.
+ Open protocol
+ Expand
2

ChIP-qPCR Analysis of TCF-Binding Motifs

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP followed by qPCR (ChIP‐qPCR) was performed as described previously.17 Real‐time PCR was performed using the KAPA SYBR FAST ABI prism kit (Kapa Biosystems, Wilmington, MA) with a set of primers encompassing the TCF‐binding motifs. Amplification of a region located between the GAPDH and the CNAP1 genes was used as the negative control.18 Sequences of the primers are shown in Table S4.
Yamaguchi K., Horie C., Takane K., Ikenoue T., Nakagawa S., Isobe Y., Ota Y., Ushiku T., Tanaka M., Fujishiro J., Hoshino N., Arisue A., Nishizuka S., Aikou S., Shida D, & Furukawa Y. (2022). Identification of odontogenic ameloblast associated as a novel target gene of the Wnt/β‐catenin signaling pathway. Cancer Science, 114(3), 948-960.
+ Open protocol
+ Expand
3

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted by TRI Reagent® (Sigma, cat. # T9494-200ML), then treated with DNAse I (New England Biolabs Inc., cat. # M0303). cDNA was synthesized using iScript Reverse Transcription Supermix (Bio-Rad, 170-8841). qPCR was performed with KAPA SYBR FAST ABI Prism Kit (KAPA Biosystems, KK4605) in an Applied Biosystems StepOnePlusTM Real-Time PCR System for 40 cycles (denaturation: 95°C, 3 seconds; annealing: 60°C, 30 seconds), followed by a default Melting Curve program. Beta-actin gene expression was used as an internal control for every sample. Ct values were measured within the geometric amplification phase, and triplicates were used to get the average value.
Gonzalez P.P., Kim J., Galvao R.P., Cruickshanks N., Abounader R, & Zong H. (2018). p53 and NF1 loss plays distinct but complementary roles in glioma initiation and progression. Glia, 66(5), 999-1015.
+ Open protocol
+ Expand
4

Quantifying Senescence Genes in Arabidopsis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from Arabidopsis leaves using the RNeasy Plant Mini Kit (Qiagen, Venlo, The Netherlands) and DNase I treatment (Qiagen). Reverse transcriptase and a poly dT primer (Thermo Fisher Scientific, Waltham, MA, USA) were used to generate cDNA. Those cDNA samples were analyzed by quantitative real-time PCR (qRT-RCR) using a KAPA SYBR FAST ABI Prism kit (KAPA Biosystems) and an ABI Prism 7500 system (Applied Biosystems). The following primers were used: AT2G29350 (SAG13, forward, 5′-CAGCTTGCCCACCCATTGTTA-3′; reverse, 5′-GTCGTACGCACCGCTTCTTTC-3′), AT5G45890 (SAG12, forward, 5′-TTGAGCATATAAAAGCGACTG-3′; reverse, 5′-GTGCACTCTCCAGTGAACACA-3′), and AT4G35770 (SEN1, forward, 5′-CCACTGCTTTTAACACAACATCA-3′; reverse, 5′-AGCAGTGAGAAGATCAGTTGAGG-3′), while Actin8 (forward, 5′-TGAGCCAGATCTTCATCGTC-3′, reverse, 5′-TCTCTTGCTCGTAGTCGACA-3′) used as the control.
c.h.a.o.m.u.r.i.l.e.g.e., Miyagi A., Ishikawa T., Yamaguchi M., Murayama H, & Kawai-Yamada M. (2023). Metabolic changes associated with dark-induced leaf senescence in Arabidopsis nadk2 mutants. Plant Signaling & Behavior, 18(1), 2215618.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!