The largest database of trusted experimental protocols

Sybr green qpcr mix

Manufactured by Biofact
Sourced in Germany

SYBR Green qPCR Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers and salts for efficient DNA amplification and detection.

Automatically generated - may contain errors

3 protocols using sybr green qpcr mix

1

Quantitative PCR Analysis of Osteoclastogenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR was designed based on consensus sequences of each alignment and performed using Rotor-gene Q (2plex on PC) instrument (QIAGEN; Hilden, Germany) with SYBR Green qPCR Mix (Biofact). The following primers were used for qPCR: RANK-forward, 5′-AGAAGACGGTGCTGGAGTCT-3′; RNAK-reverse, 5′-TAGGAGCAGTGAACCAGTCG-3′; TRAF6-forward, 5′-GCCCAGGCTGTTCATAATGT-3′; TRAF6-reverse, 5′-TCGCCCACGTACATACTCTG-3′; OSCAR-forward, 5′-CTGCTGGATACGGATCAGCTCCCCAGA-3′; OSCAR-reverse, 5′-CCAAGGAGCCAGAACCTTCGAAACT-3′; TRAP-forward, 5′-CAGTTGGCAGCAGCCAAGGAGGAC-3′; TRAP-reverse, 5′-TCCGRGCTCGGCGATGGACCAGA-3′; Blimp1-forward, 5′-TGCTTATCCCAGCACCCC-3′; Blimp1-reverse, 5′- CTTCAGGTTGGAGAGCTGACC -3′; c-fos-forward, 5′-AGAGCGGGAATGGTGAAGAC-3′; c-fos-reverse, 5′-GCTGCATAGAAGGAACCGGA-3′; NFATc1-forward, 5′- CAACGCCCTGACCACCGATAG -3′; NFATc1-reverse, 5′-GGGAAGTCAGAAGTGGGTGGA-3′; MafB-forward, 5′-AGTGTGGAGGACCGCTTCTCT-3′; MafB-reverse, 5′-CAGAAAGAACTCAGGAGAGGAGG-3′; IRF-8-forward, 5′AGACGAGGTTACGCTGTGC-3′; IRF-8-reverse, 5′- TCGGGGACAATTCGGTAAACT -3′. Data were normalized against the expression of GAPDH as an internal control.
+ Open protocol
+ Expand
2

qPCR Analysis with Rotor-gene Q

Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR analyses were conducted using the Rotor‐gene Q (2plex on PC) instrument (QIAGEN) with SYBR Green qPCR Mix (Biofact). The primers used for qPCR analyses were presented in Table 1. Data were normalized against the expression of GAPDH as an internal control.
+ Open protocol
+ Expand
3

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA extraction was performed using TRIzol reagent (15596018; Invitrogen, Carlsbad, CA, USA) following to the manufacturer’s instructions. cDNA was generated using the WizScript cDNA Synthesis Kit (W2202; Wizbiosolutions, Seongnam, Korea) with oligo-dT primer. Quantitative polymerase chain reaction (qPCR) next was performed using a Step OnePlus RT-PCR system (Applied Biosystems, Foster City, CA, USA) with specific primers (Table 1) and SYBR Green qPCR Mix (DQ485; BioFACT, Daejeon, Korea). The cycle threshold (Ct) value was confirmed using Step One software version 2.3 (Applied Biosystems, USA), and the mRNA fold-change value was determined using the 2 (−ΔΔCt) method [20 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!