pK1-5 and pMock were amplified using the E. coli K12 strain DH10B and plasmid vectors were isolated using the NucleoBond Xtra Maxi Plus EF system (Macherey-Nagel, Düren, Germany). DNA content and purity were determined by measuring the OD260/280 ratio.
Pcmvtnt
PCMVTNT is a plasmid vector designed for the expression of proteins in mammalian cells. It contains a cytomegalovirus (CMV) promoter for high-level expression, as well as a neomycin resistance gene for selection of transfected cells.
Lab products found in correlation
10 protocols using pcmvtnt
Recombinant Expression and Validation of Plasminogen K1-5
pK1-5 and pMock were amplified using the E. coli K12 strain DH10B and plasmid vectors were isolated using the NucleoBond Xtra Maxi Plus EF system (Macherey-Nagel, Düren, Germany). DNA content and purity were determined by measuring the OD260/280 ratio.
Microsomal Epoxide Hydrolase Protein Expression
Expressing Myc-tagged PIG Proteins in S2 Cells
GST Pull-Down Assay for Cdk4-Ink4d Interaction
Construction of GLI1/GLI2 Expression and Reporter Vectors
Cloning and Expression of ENTREP in MCF-7 Cells
ENTREP cDNA was amplified from MCF‐7 cells using high‐fidelity PrimeSTAR GXL DNA polymerase (TAKARA) and cloned into the pBluescript II plasmid (Agilent). The following PCR primers were used for amplification: forward primer, 5′‐ccggaattcggtcgccaccatgatactcctggtaaacctctttgtg‐3′; reverse primer, 5′‐acgcgtcgactcacaggacagtctctcggatgac‐3′. The sequence was identical to that of FAM189A2 isoform b (NM_001127608.3) and was registered as ENTREP under accession number LC496047.1 in the DDBJ/EMBL‐EBI/GenBank database. The pRK5‐HA‐Ubiquitin plasmids were kind gifts from Dr. Ted Dawson (Johns Hopkins University) through Addgene. The plasmid vectors encoding human ENTREP, ITCH, EPN1, and CXCR4 were constructed from pcDNA3.1‐myc/HIS (Invitrogen), pCMVTNT, pFN21A HaloTag CMV Flexi (Promega), pEGFP, and pDsRed‐monomer vectors (Clontech). The expression vectors were schematically presented in Appendix Fig
Plasmid Construction for Protein Expression in Insect and Mammalian Cells
GST Pull-Down Assay for Cdk4-Ink4d Interaction
GST pull down assays were performed as described [22 (link)]. Briefly, in vitro transcribed and translated Xl-Cdk4 (20 μl) was incubated with 1 μg of purified GST, GST-Xl-Ink4d1 (Xenopus), or GST-Mm-Ink4d (mouse) proteins immobilized on glutathione sepharose. The mixture was incubated at 4°C for 2 hour and washed several times in IP kinase buffer (50 mM HEPES pH 7.5, 10 mM MgCl2, 1 mM DTT, 2.5 mM EGTA, 10 mM β-glycerophosphate, 0.1 mM sodium orthovanadate, 1 mMNaF). Bound proteins were denatured and separated on a 12% (w/v) polyacrylamide-SDS gel and visualized by autoradiography [23 ].
Construction of Recombinant Expression Vectors
Cloning and Transfection of Influenza Reporter Constructs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!