Ab112580

Manufactured by Abcam

Sourced in United Kingdom

Ab112580 is a laboratory product. It is a reagent used for scientific research purposes.

Automatically generated - may contain errors

Lab products found in correlation

Ecl kit, by Beyotime (2 mentions) Total cell protein extraction kit, by Vazyme (2 mentions) Ab172730, by Abcam (2 mentions) Reverse transcription kit, by Takara Bio (1 mentions) Sybr green master mix kit, by Roche (1 mentions) Rnaiso plus, by Takara Bio (1 mentions) Ab32174, by Abcam (1 mentions) Ab33911, by Abcam (1 mentions) Hairpin it mirna qpcr quantitation kit, by GenePharma (1 mentions) Polyvinylidene fluoride membrane, by Thermo Fisher Scientific (1 mentions) Bca protein quantification kit, by Vazyme (1 mentions) Ab6785, by Abcam (1 mentions) Rip kit, by Merck Group (1 mentions) Tcs spii 5 confocal microscope, by Leica (1 mentions) Ab56416, by Abcam (1 mentions) S6639, by Merck Group (1 mentions) Am8670, by Thermo Fisher Scientific (1 mentions) Co ip buffer, by Beyotime (1 mentions) Gapdh, by Abcam (1 mentions) Ab38449, by Abcam (1 mentions)

9 protocols using ab112580

Breast Cancer miRNA and Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted with RNAiso Plus (Takara, Kusatsu, Japan) from collected clinical samples and chosen breast cancer cells, according to the manufacturer's protocol. cDNA was specifically synthesized for miRNA, and then was tested using the Hairpin-it miRNA qPCR Quantitation Kit (GenePharma, China). Other cDNA was synthesized by the reverse transcription kit (Takara), and then detected by the SYBR Green Master Mix Kit (Roche, Reinach, Switzerland). The expressions were normalized based on U6 or GAPDH, respectively. The primers for targets are listed in Supplementary Table 1.
The primary antibodies utilized for western blot were as follows: anti-CCNE1 (Abcam, Cambridge, UK, 1:1,000, ab33911), anti-CDK2 (Abcam, 1:3,000, ab32174), anti-c-Myc (Abcam, 1:1,000, ab32072), anti-E2F1 (Abcam, 1:1,000, ab 112580), and anti-GAPDH (Abcam, 1:2,500, ab9485). The secondary antibodies (GOAT anti-mouse and anti-rabbit IgG) were from Jackson Immunoresearch (USA).

Chen L., Miao X., Si C., Qin A., Zhang Y., Chu C., Li Z., Wang T, & Liu X. (2021). Long Non-coding RNA SENP3-EIF4A1 Functions as a Sponge of miR-195-5p to Drive Triple-Negative Breast Cancer Progress by Overexpressing CCNE1. Frontiers in Cell and Developmental Biology, 9, 647527.

+ Open protocol

+ Expand

Western Blotting Protein Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blotting was performed as described previously 36 (link). The protein samples were prepared by a total cell protein extraction kit (Vazyme, Nanjing, China). BCA protein quantification kit (Vazyme) was used for concentration determination. 40 μg protein samples were transferred to polyvinylidene fluoride membranes (Thermo Fisher Scientific) after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then blocked with fat-free milk. The primary antibodies against E2F1 (1:1000, #ab112580, Abcam, Cambridge, UK), β-actin (1:2000, #66009-1-Ig, ProteinTech, Chicago, IL, USA) were used. ECL kits (Beyotime Biotechnology, Beijing, China) and IMAGE J software (National Institutes of Health, Bethesda, MD, USA) were used to quantify the signal intensity.

Hou D., Wang Z., Li H., Liu J., Liu Y., Jiang Y, & Lou M. (2022). Circular RNA circASPM promotes the progression of glioblastoma by acting as a competing endogenous RNA to regulate miR-130b-3p/E2F1 axis. Journal of Cancer, 13(5), 1664-1678.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation to Identify E2F1 Binding Sites

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were exposed to 20% O₂ for 24 h, crosslinked with 1% formaldehyde for 10 min and quenched in 0.125 M glycine. Protein samples were extracted using lysis buffer (50 mM Tris-HCl, 10 mM EDTA, 1% SDS, protease inhibitor cocktail) and sonicated. Next, the protein mixture was subjected to immunoprecipitation overnight at 4°C in the presence of salmon sperm DNA/protein A beads with antibodies against E2F1 (Abcam, ab112580) or IgG (Abcam, ab172730). Precipitated chromatin DNA was extensively washed, eluted with freshly prepared elution buffer (0.1 M NaHCO3, 1% SDS), decrosslinked at 65°C for 4 h followed by treatment with proteinase K at 45°C for 45 min, purified with phenol/chloroform/isoamyl alcohol (25:24:1, v/v), and quantified by RT-qPCR assay. 2^−∆∆Ct method was used for analysis of the results. In this study, two potential binding sites (E1 and E2) were identified. Primers for RT-qPCR of ZEB1 promoter region were as follows: ZEB1 (E1), Forward: 5’- ATCTGTCAGCCGATGCTTCT −3’, Reverse: 5’- CACACGGTGCTTGTCTCACT −3’; ZEB1 (E2), Forward: 5’- CAGGGTCAGAAAAGGTCAACA −3’, Reverse: 5’- CCTTCAGTGTTCATCCTCACC −3’.

Gong H., Lu F., Zeng X, & Bai Q. (2022). E2F transcription factor 1 (E2F1) enhances the proliferation, invasion and EMT of trophoblast cells by binding to Zinc Finger E-Box Binding Homeobox 1 (ZEB1). Bioengineered, 13(2), 2360-2370.

+ Open protocol

+ Expand

ChIP-Seq Analysis of E2F1 Binding in Glioma

Check if the same lab product or an alternative is used in the 5 most similar protocols

The glioma cells were fixed in methanol for 10 min for DNA‐protein crosslinking. The cells were fractured via ultrasonication to obtain chromatin fragments. The fragments were centrifuged at 4℃ for 10 min at 12,000 rpm to collect the supernatant into two tubes. The tube was incubated with anti‐IgG (negative control) (1:2500; Abcam Cat#: ab6785; RRID: AB_955241; Abcam Inc. ) or anti‐E2F1 (1:1000, Abcam Cat#: ab112580; RRID: none; Abcam Inc.) at 4℃ overnight. The DNA‐protein complex was precipitated using Protein A agarose and was centrifuged for 5 min at 12,000 rpm to discard the supernatant. The non‐specific binding complexes were washed away, and the specific binding ones were de‐crosslinked at 65℃ overnight. The DNA fragments were extracted using phenol/chloroform, purified, and collected. Enriched fragments in the miR‐107 promoter were examined by qPCR.

Xie H., Lv S., Wang Z, & Yuan X. (2021). E2F transcription factor 1 elevates cyclin D1 expression by suppressing transcription of microRNA‐107 to augment progression of glioma. Brain and Behavior, 11(12), e2399.

+ Open protocol

+ Expand

RIP-qPCR Assay of MCM3AP-AS1 and E2F1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The binding of MCM3AP-AS1 to the transcription factor E2F1 protein was detected using RIP kits (Merck Millipore, Billerica, MA, USA). Cells were lysed with equal amounts of lysate for 5 min, and were then centrifuged at 20,000 × g for 10 min at 4°C. Each coprecipitation reaction system was washed with 50 μL of magnetic beads and resuspended in 100 μL of RIP Wash Buffer, followed by incubation with 1 μg of antibody. The magnetic bead-antibody complex was then washed and resuspended in 900 μL of RIP Wash Buffer, and 100 μL of the cell extract was added for incubation at 4°C overnight. Next, the sample was placed on a magnetic stand to collect the magnetic bead-protein complex. The sample was detached with proteinase K to extract RNA for subsequent RT-qPCR. The antibody used for RIP was E2F1 antibody (ab112580, dilution ratio of 1:200, Abcam, Cambridge, UK). An IgG antibody (ab172730, dilution ratio of 1:100, Abcam, Cambridge, UK) was used as NC.

Qiu L., Ma Y., Yang Y., Ren X., Wang D, & Jia X. (2020). Pro-Angiogenic and Pro-Inflammatory Regulation by lncRNA MCM3AP-AS1-Mediated Upregulation of DPP4 in Clear Cell Renal Cell Carcinoma. Frontiers in Oncology, 10, 705.

+ Open protocol

+ Expand

In Situ Hybridization of Circular FoxO3

Check if the same lab product or an alternative is used in the 5 most similar protocols

The circ-FoxO3 conjugated with CY5 used for in situ hybridization was designed and synthesized by Sangon Biotech according to a previous study.²³ (link) Tissues or the BMECs (bEnd.3 or HBMEC) were washed twice with cold 1× DEPC PBS, and then were fixed with 4% PFA for 20 min. Permeability was performed for the tissues or BMECs with 0.25% Triton in PBS for 15 min. The samples were incubated in hybridization solution (Thermo Fisher Scientific, AM8670) containing 50 nmol/L CY5-labeled circ-FoxO3 probes at 55°C for 3 h after prehybridization in hybridization solution for 1 h at 37°C. Subsequently, the samples were washed with 2× SSC (Sigma-Aldrich, S6639) at 42°C and incubated in blocking buffer (0.5% BSA in PBST) before incubation with anti-CD31 antibody (Abcam, ab24590), PDGFR-β (CST, 3169), GFAP (CST, 3670), anti-mTOR (CST, 2983), anti-E2F1 (Abcam, ab112580), anti-SQSTM1/p62 (Abcam, ab56416), Alex Fluro 488-conjugated goat anti-mouse or rabbit IgG (Jackson Laboratory, 115-095-003; CST, 4412), and DAPI. Finally, the samples were captured using a Leica TCS SPII 5 confocal microscope (Leica, Solms, Germany). The sequences of probes are listed in Figure S1B.

Yang Z., Huang C., Wen X., Liu W., Huang X., Li Y., Zang J., Weng Z., Lu D., Tsang C.K., Li K, & Xu A. (2021). Circular RNA circ-FoxO3 attenuates blood-brain barrier damage by inducing autophagy during ischemia/reperfusion. Molecular Therapy, 30(3), 1275-1287.

+ Open protocol

+ Expand

Isolation and Detection of circ-FoxO3

Check if the same lab product or an alternative is used in the 5 most similar protocols

BMECs (bEnd.3 or HBMEC) with 3 × 10⁷ cells were lysed in 500 μL co-IP buffer (Beyotime Biotechnology), and incubated with 5 μg of mTOR (CST, 2983) or E2F1 (Abcam, ab112580) at room temperature for 1.5 h. Subsequently, each sample was added to 100 μL magnetic beads and then incubated overnight on a rotating wheel at 4°C. After washing and centrifugation, the pellets were re-suspended in 0.5 mL TRI Reagent. The pull-down RNA was treated with or without RNase R. After being reverse-transcribed into cDNA, the level of circ-FoxO3 was analyzed by quantitative RT-PCR.

+ Open protocol

+ Expand

Western Blot Analysis of Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein content was extracted from cells or tissues, followed by detection of protein concentration of each sample. Subsequently, the obtained proteins were transferred onto polyvinylidene fluoride membranes after separation with 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis. Next, the membranes were sealed with 5% skim milk powder and then incubated with the following primary antibodies: E2F1 (ab112580, dilution ratio of 1 : 1000), phosphatidylinositol-3 kinase (PI3K) (ab32089, dilution ratio of 1 : 1000), p-PI3K (ab182651, dilution ratio of 1 : 1000), protein kinase B (AKT) (ab18785, 1/500), and p-Akt (ab38449, dilution ratio of 1 : 500) (all from Abcam Inc., Cambridge, MA, USA) at 4°C overnight. The following day, the membranes were cultured with secondary antibody immunoglobulin G antibody (ab97051, dilution ratio of 1 : 20000) (Abcam) at 37°C for 1 h through percussion. Afterwards, the membranes were immersed in an enhanced chemiluminescence reagent (Pierce, Waltham, MA, USA) for 1 min, followed by exposure, visualization and fixation in conditions void of light. GAPDH (ab9485, dilution ratio of 1 : 1000) (Abcam) was adopted as the internal reference. The Image J2x V2.1.4.7 software (Rawak Software, Inc. Dresden, Germany) was utilized for analysis of the Western blot images.

Yang J., Ying Y., Zeng X., Liu J., Xie Y., Deng Z., Hu Z, & Li Z. (2022). Transcription Factor E2F1 Exacerbates Papillary Thyroid Carcinoma Cell Growth and Invasion via Upregulation of LINC00152. Analytical Cellular Pathology (Amsterdam), 2022, 7081611.

+ Open protocol

+ Expand

Western Blotting for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blotting was performed as described previously (29) . The protein samples were prepared by a total cell protein extraction kit (Vazyme, Nanjing, China). BCA protein quanti cation kit (Vazyme) was used for concentration determination. 40 µg protein samples were transferred to polyvinylidene uoride membranes (Thermo Fisher Scienti c) after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then blocked with fat-free milk. The primary antibodies against E2F1 (1:1000, #ab112580, Abcam, Cambridge, UK), β-actin (1:2000, #66009-1-Ig, ProteinTech, Chicago, IL, USA) were used. ECL kits (Beyotime Biotechnology, Beijing, China) and IMAGE J software (National Institutes of Health, Bethesda, MD, USA) were used to quantify the signal intensity.

Hou D., Wang Z., Li H., Liu J., Liu Y., Jiang Y., & Lou M. (2020). Circular RNA circASPM Promotes the Progression of Glioblastoma by Acting as a Competing Endogenous RNA to Regulate miR-130b–3p/E2F1 Axis.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!