Truseqfi dna pcr free sample preparation kit

Total DNA was extracted from the intestines using a fecal genomic DNA extraction kit and bacterial genomic DNA extraction kit (Tiangen, China). The qPCR reaction consisted of 2.0 μL of 10-fold diluted DNA, 10 μL of SYBR Green, and 0.8 μL of each primer (10 μM) in a total volume of 20 μL. The PCR program comprised 45 cycles at 95 °C (35 s), 60 °C (30 s), and 72 °C (30 s), followed by melt curve generation. Melt curves were analyzed to check the specificity of amplification. Gene-specific primers were designed as:
Pseudomonas, Pse-F, CTGCATCATGGCCGGTGACAACATTT, Pse-R, GTCGCATGGCTGTCGGTCTTCAGATC, were used to qPCR for Pseudomonas.
Bacterial primers, 27-F, AGAGTTTGATCCTGGCTCAG, 1492-R, GGTTACCTTGTTACGACTT, were used to qPCR for total number of bacteria.
Bacterial primers 341-F (50-CCT AYG GGR BGC ASC AG-30) and 806-R (50-GGA CTA CNN GGG TAT CTA AT-30) were used to amplify the V3–V4 region of bacterial 16SrRNA genes. The sequencing library of bacterial 16 S rRNA genes was generated for high-throughput sequencing, employing the TruSeqfi DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA). Next, the library was sequenced on an Illumina HiSeq2500 platform by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China).

The DNA of fish intestine was extracted using a fecal genomic DNA Extraction Kit (Tiangen, Beijing, China). Bacterial primers 341-F (50-CCT AYG GGR BGC ASC AG-30) and 806-R (50-GGA CTA CNN GGG TAT CTA AT-30) were used to amplify the V3-V4 region of bacterial 16S rRNA genes. The sequencing library of bacterial 16S rRNA genes was generated for high-throughput sequencing, employing the TruSeqfi DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA). Next, the library was sequenced on an Illumina HiSeq2500 platform manufactured by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). The NCBI sequence read archive was used for data analysis.