Chip it express enzymatic shearing and chip protocol

HepG2 cells were mock-infected or infected with ZIKV. 48 h p.i. cells were prepared following ChIP-IT Express Enzymatic Shearing and ChIP protocol (#53009, Active Motif). Briefly, cells were fixed in 1%formaldehyde, washed in PBS and glycine Stop-Fix solution. Cells were pelleted, and chromatin was sheared using the Enzymatic Shearing Cocktail (Active Motif) for 10 min at 37°C. Shared chromatin as immunoprecipitated with 5 μg of antibody (anti-AHR, anti-NF-κB or control IgG) overnight at 4°C with rotation. The next day, magnetic beads were washed and cross-links were reversed in 0.1%SDS and 300 mM NaCl TE buffer at 63°C for 4 h. DNA fragments were purified using QIAquick PCR Purification Kit (#28104, QIAGEN). qPCR was performed using Fast SYBR Green Master Mix (#4385612, Thermo Fisher Scientific). The following primer pairs were used: AHR Binding site 1 forward, 5′-CGTAAGTCAGCGGTAGGTCTG -3′, and reverse, 5′-AGAGGCCGACTGTGGGTTTT -3′; AHR Binding site 2, 5′-CAGCTGTGGGCTCTCCTTTC -3′, and reverse, 5′-TACGGTAAAGCGGGAGAGGTA-3′; AHR Binding site 3 forward, 5′-TGACATGCTTTTCCATTGGCG -3′and reverse, 5′-AGCAGGATGATGCCTTGAGT-3′; AHR Binding site 4 forward, 5′-AGATGGCTGCCCACCATATTT-3′, and reverse, 5′-TGATAGGGCCTGGCTCTTGTA-3′; NFκB Binding site forward, 5′-CCCACCACCTACAACCCTAAA-3′, and reverse, 5′- CATTCTGGAAAGGAGAGCCC -3′

BMDCs or T cells activated as described above were cultured with propyzamide or vehicle. After 48 h, cells were prepared according to the ChIP-IT Express Enzymatic Shearing and ChIP protocol (53009, Active Motif). In brief, cells were fixed in 1% formaldehyde, washed in PBS and glycine Stop-Fix solution. Cells were pelleted, and chromatin was sheared using the Enzymatic Shearing Cocktail (Active Motif) for 10 min at 37 °C. Sheared chromatin was immunoprecipitated with 5 μg of anti-C/EBPβ antibody (ab15050, Abcam) or mouse IgG control (ab37355, Abcam) overnight at 4 °C with rotation. The next day, magnetic beads were washed, and cross-links were reversed in 0.1% SDS and 300 mM NaCl TE buffer at 63 °C for 4 h. DNA fragments were purified using the QIAquick PCR Purification Kit (28104, Qiagen). qPCR was performed using the Fast SYBR Green Master Mix (4385612, Thermo Fisher Scientific). The following primer pairs were used: CEBP Il23 site 1 F, CATGACACGGGAACCAGACT; R, AGGGGCAGGGAAGTAATGGA; CEBP Il23 site 2 F, AACTTTTGAGAGCCTGCCGT; R, GTACAGCGATGATGACCCGT; CEBPB Rorc F, CGAAGCTCCCCAGCTAGAAC; R, GGGGTTTAAGCTCTGCTCCA; CEBPB Il12rb1 F, CCTTCAGCCCTGCAGAAGTT; R. GGCCACAAGGACAAAGAGGA; CEBPB Ifng F, GAGAGCCCAAGGAGTCGAA; R, TACCTGATCGAAGGCTCCTC; CEBPB Tnf F, GTGGAGAAAGACGGGGATG; R, ATCTGCTTGTTCATTCATTCATTC; CEBPB Il1b F, TCTCTTTATCTGGGGTGTGAGTT; R, AGCCCTCAGGTAGAGGAACC.