Fast start master sybr green kit

Manufactured by Roche

Sourced in United States

The Fast Start Master SYBR Green Kit is a laboratory reagent designed for real-time polymerase chain reaction (PCR) analysis. It contains all the necessary components, including SYBR Green I, for the amplification and detection of DNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Powerscript reverse transcriptase, by Takara Bio (2 mentions) Rneasy rna mini kit, by Qiagen (2 mentions) Lightcycler, by Roche (2 mentions) Real quant software, by Roche (1 mentions)

Close spelling variants of this product

LC Fast Start DNA Master SYBR Green kit Fast-Start™ DNA Master SYBR Green I real-time PCR kit Fast start SYBR Green Kit Fast SYBR Green Master Kit Fast SYBR Green SYBR Green kit SYBR Green

2 protocols using fast start master sybr green kit

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 100 mg tissues or 1 × 10⁵ cells using the RNeasy RNA Mini Kit (Qiagen). First strand cDNA was synthesized using POWERSCRIPT reverse transcriptase (Clontech). The following gene-specific primer pairs were used for quantitative PCR:

BRG1: Forward, 5′- TCATGTTGGCGAGCTATTTCC -3′;

Reverse, 5′- GGTTCCGAAGTCTCAACGATG-3′.

MMP2: Forward, 5′- TTACTTGTGGAGCCGCTGAC -3′;

Reverse, 5′- TCAGATGGTGCCAGCAATAG -3′.

MMP9: Forward, 5′- GCTATTTCGGCATGTTGATCC -3′;

Reverse, 5′- GAAGTTAACCTCGGATCCTGG-3′.

GAPDH: Forward, 5′- GCTGAGTATGTCGTGGAGTC -3′;

Reverse, 5′- AGTTGGTGGTGCAGGATGC -3′.

PCR was performed using a Fast Start Master SYBR Green Kit (Roche) on a LightCycler (Roche). The expression level of target gene mRNA was analyzed using RealQuant software (Roche) and normalized to that of GAPDH mRNA.

Yuan Y., Wang C., Xu J., Tao J., Xu Z, & Huang S. (2014). BRG1 overexpression in smooth muscle cells promotes the development of thoracic aortic dissection. BMC Cardiovascular Disorders, 14, 144.

+ Open protocol

+ Expand

Quantitative Analysis of miRNA and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA in fresh clinical tissue specimens and cells was extracted using the RNeasy RNA Mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. First-strand cDNA was synthesized using PowerScript reverse transcriptase (Clontech, San Jose, CA, USA) according to the manufacturer's instructions. Following cDNA synthesis, real-time PCR was performed using a Fast Start Master SYBR-green kit on a LightCycler (both from Roche Molecular Systems, indianapolis, iN, USA) according to the manufacturer's instructions. The sequence-specific primer pairs used for quantitative PCR are listed as following: miR-30d forward, 5'-UgU AAA CAU CCC CgA CUg gAA g-3' and reverse, 5'-TgT AAA CAT CCC CgA CTg gAA gA-3'; U6 forward, 5'-CTC gCT TCg gCA gCA CA-3' and reverse, 5'-AAC gCT TCA CgA ATT TgC gT-3'; EZH2 forward, 5'-TTA CTT gTg gAg CCg CTg AC-3' and reverse, 5'-TCA gAT ggT gCC AgC AAT Ag-3'; gAPDH forward, 5'-gCT gAg TAT gTC gTg gAg TC-3' and reverse, 5'-AgT Tgg Tgg TgC Agg ATg C-3'. Relative expression levels of miRNA and mRNA expression in fresh tissues and cells were determined using the 2 -ΔΔCt method. Each sample was examined in triplicate.

Xie R., Wu S.N., Gao C.C., Yang X.Z., Wang H.G., Zhang J.L., Yan W, & Ma T.H. (2017). MicroRNA-30d inhibits the migration and invasion of human esophageal squamous cell carcinoma cells via the post‑transcriptional regulation of enhancer of zeste homolog 2. Oncology reports, 37(3).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!