Lightcycler 96 qpcr

RT-qPCR was conducted in a two-step assay. After the RT, we used the SuperReal PreMix Plus (TIANGEN) to prepare the mixture and LightCycler 96 qPCR instrument (Roche) to run the reaction (a pre-cycling hold for 15 min at 95°C, 40 cycles for 10 s at 95°C, 20 s at 60°C, 20 s at 72°C, one melting cycle for 10 s at 95°C, 60 s at 65°C, 1 s at 97°C). The primers were designed by The Primer3 (https://primer3.ut.ee). The 20-μL reaction mixture contained 10 μL of 2× SuperReal PreMix Plus buffer, 0.4 μL each of 10 μM forward and reverse primers, 8.6 μL of H₂O, and 1 μL of the 1:15 dilution cDNA. The xlactb.L was a reference gene. qPCR primers are as follows: xlmc3r.L_fw GGTGAACGCCACTCTGGACCC; xlmc3r.L_rev ATCAGCCACGGCCAGGCTG; xlmc3r.S_fw GGTCAACACCACCCTGAACCT; xlmc3r.S_rev GTCGGCCACGGCCAGGCTA; xlactb.L_fw TTCACCACCACAGCCGAAAG; xlactb.L_rev TGTCCGTCAGGCAGCTCATA. Experiments were replicated independently at least three times.

The Ezup Column Bacterial Genomic DNA Extraction Kit was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The RAA nucleic Acid Amplification Kit was bought from Jiangsu Qitian Gene Biotechnology Co., Ltd. (Jiangsu, China). Oligonucleotides were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The oligonucleotide sequences used in this study are listed in Table S1. Cas12a was purchased from New England Biolabs. The Cas12/13 special nucleic acid test strip and 1 × Buffer were purchased from Guangzhou Bio-lifesci Co., Ltd. (Guangzhou, China). DEPC water (DNase-/RNase-free) and the Ribonuclease Inhibitor (RNase Inhibitor) were obtained from Beyotime Institute of Biotechnology (Shanghai, China). Tris-saturated Phenol was purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). Gelstain was bought from TransGen Biotech Co., Ltd. (Beijing, China). All reagents were used as received and without further purification.
The oligonucleotide annealing process and RAA reaction were carried out by T100 Thermal Cycler PCR (from Bio-Rad, Tokyo, Japan). Gel imaging was performed using the Tanon 1200 imaging system. The fluorescence spectra were measured by the LightCycler96 qPCR (from Roche, Basel, Switzerland).

Total RNA was extracted from leaves infected by Pt at 0, 12, 48 and 96 hours post inoculation (hpi). First-strand cDNA was synthesized from an equal amount of RNA using a PrimeScript Reverse Transcriptase kit (TaKaRa, Beijing, China). The β-actin gene (GenBank accession ADAS02000088.1: 291774-292,960) encoding β-actin protein was used as an internal reference gene, and 3 independent biological replicates were used in the experiments. The quantitative reverse transcription PCR (qPCR) reactions were conducted using a TransStart R Top Green qPCR SuperMix (TransGen, Beijing, China) with a Roche-LightCycler 96 qPCR instrument (Roche, Basel, Switzerland) using different primers designed according to different candidates. The transcriptional abundance of genes was quantitated relative to that of the β-actin following the 2^−ΔCT method (Ridout et al., 2006 (link)).