Erk1 2 sc 514302

The ssDNA library used in this study contained a random sequence of 40 nucleotides flanked by a 5′ primer‐hybridizing sequence of 22 nucleotides and a 3′ primer‐hybridizing sequence of 24 nucleotides (5′‐GGAGGGAAAAGTTATCAGGC‐(N)40‐GATTAGTTTTGGAGTACTCGCTCC‐3′). The SL1 sequence was as follows: 5′‐ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT‐3′. All DNA sequences were synthesized and HPLC‐purified by Sangon Biotech Co. Ltd. (Shanghai, China). Recombinant human HGF (#100‐39) was obtained from Peprotech (Rocky Hill, NJ, USA). Tivantinib/ARQ197 (S2753) was purchased from Selleck Chemicals (Houston, TX, USA). Antibodies against c‐met (#8198), phosphorylated c‐met (#3133), and GAPDH (#5174) were purchased from Cell Signaling Technology (Boston, MA, USA). Antibodies against α‐tubulin (sc‐5286), p‐ERK (sc‐7383), Akt1 (sc‐5298), p‐Akt (sc‐16646‐R), and ERK1/2 (sc‐514302) were purchased from Santa Cruz (Santa Cruz, CA, USA). CD138 microbeads (130‐051‐301) were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany).

Cells were lysed in the RIPA buffer supplemented with cocktails of protease/phosphatase inhibitors (Cell Signaling Technology, Beverly, MA, USA). Proteins (20 μg) were separated using a 10% SDS–polyacrylamide gel and the Bio-Rad electroporation system and then transferred onto PVDF membranes (Millipore, Billerica, MA, USA). CD46 antibodies were obtained from OriGene Technologies, Inc. (TA306994, Rockville, MD, USA).
CD55 (sc-51733), CD59 (sc-133170), p-AKT (sc-514032), AKT (sc-5298), p-ERK1/2 (sc-136521), and ERK1/2 (sc-514302) were procured from Santa Cruz Biotechnology (SantaCruz, CA, USA). β-Actin antibodies were obtained from Sigma-Aldrich (A5441, St. Louis, MO, USA). The bands were visualized and analyzed using the Immobilon Western detection system (Millipore, Billerica, MA, USA) and ChemiDOC™ MP Gel Imaging System (Bio-Rad, Hercules, CA, USA).

Antibodies for HSP90 (sc-7947) and ERK1/2 (sc514302) were purchased from Santa Cruz Biotechnology. The ERα (MA5-14104) antibody was purchased from ThermoFisher. PARP (9542), EGFR (4267), Akt (40D4), p-Akt Ser473 (4060), ß-actin (4967), and p-ERK1/2 p44/42 (9102) antibodies were obtained from Cell Signalling Technology. Antibody against p-EGFR Y1068 (ab5644) was provided by Abcam.