Log In Sign up
The largest database of trusted experimental protocols

Seqman pro software

Manufactured by DNASTAR
Visit Supplier
Sourced in United States

SeqMan Pro is a DNA sequence assembly and analysis software from DNASTAR. It is designed to assemble and analyze DNA sequence data from various sources, including Sanger sequencing, next-generation sequencing, and capillary electrophoresis. The software provides tools for sequence alignment, contig assembly, and quality assessment.

Automatically generated - may contain errors

Lab products found in correlation

Veriti 96 well thermal cycler, by Thermo Fisher Scientific (2 mentions) Invitrogen platinum pcr supermix hi fi, by Thermo Fisher Scientific (2 mentions) Exosap it, by GE Healthcare (2 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions) Qiaamp dna mini kit, by Qiagen (1 mentions) Bigdye terminator v1.1 kit, by Thermo Fisher Scientific (1 mentions) Genomic dna mini kit, by Thermo Fisher Scientific (1 mentions) Sequence analyser 3130xl, by Thermo Fisher Scientific (1 mentions) Megalign, by DNASTAR (1 mentions) Bigdye terminator v3.1 cycle sequencing reagents, by Thermo Fisher Scientific (1 mentions) Biospin fungus genomic dna extraction kit, by Bioer (1 mentions) Dna blood kit, by Qiagen (1 mentions) Qiacube, by Qiagen (1 mentions) Purelink pcr purification kit, by Thermo Fisher Scientific (1 mentions) Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions) Purelink quick plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions) 3730xl dna analyser, by Thermo Fisher Scientific (1 mentions) Exosap it, by Thermo Fisher Scientific (1 mentions) Invitrogen platinum pcr supermix, by Thermo Fisher Scientific (1 mentions) Applied biosystems 3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

SeqMan (181 citations) SeqMan Pro (124 citations) SeqMan software (122 citations)

30 protocols using seqman pro software

1

Genomic Sequencing of Obesity Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The coding region of the genes CKB (chr14: 103,519,667–103,552,833; GRCh38; ENST00000348956.7), CKMT1B (chr15: 43,593,054–43,604,901; GRCh38; ENST00000441322.6), and GATM (chr15: 45,361,124–45,402,327; GRCh38; ENST00000396659.8) were Sanger sequenced in 192 children and adolescents with severe obesity and 192 healthy-lean controls (see Table 2). The CDS of CKB was further analyzed in 192 female patients with AN (see Table 2). The respective genomic fragments were amplified by performing polymerase chain reactions (PCR; Veriti96-well Thermal Cycler, Applied Biosystems, Foster City, CA, United States) with coding region-specific primers (see Supplementary Table S1). For the amplification of the CDS of CKMT1B, a nested PCR approach was conducted (see Supplementary Table S1). Confirmation of the desired fragments was achieved by 2.5% agarose gel electrophoresis. Subsequent Sanger sequencing was performed by MicroSynth Seqlab GmbH in Göttingen, Germany. Sequence analysis and genotype assignment were conducted independently by at least two experienced scientists using the SeqMan Pro software (version: 11.0.0; DNAstar, Inc., Madison, WI, United States). Discrepancies were solved by either reaching consensus or by re-sequencing.
Rajcsanyi L.S., Hoffmann A., Ghosh A., Matrisch-Dinkler B., Zheng Y., Peters T., Sun W., Dong H., Noé F., Wolfrum C., Herpertz-Dahlmann B., Seitz J., de Zwaan M., Herzog W., Ehrlich S., Zipfel S., Giel K., Egberts K., Burghardt R., Föcker M., Tsai L.T., Müller T.D., Blüher M., Hebebrand J., Hirtz R, & Hinney A. (2023). Genetic variants in genes involved in creatine biosynthesis in patients with severe obesity or anorexia nervosa. Frontiers in Genetics, 14, 1128133.
+ Open protocol
+ Expand
2

Bidirectional Sanger Sequencing for Mutation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bidirectional Sanger sequencing was performed over the prioritized mutations with variant allele frequencies >0.15 on all tumor samples. Genomic DNA (10ng) was used as template in PCR amplifications with Invitrogen Platinum PCR Supermix Hi-Fi (Life-Technologies) with the suggested initial denaturation and cycling conditions. PCR products were subjected to bidirectional Sanger sequencing for both primer pairs by the University of Michigan DNA Sequencing Core after treatment with ExoSAP-OT (GE Healthcare) and sequences were analyzed using SeqMan Pro Software (DNASTAR).
de la Vega L.L., Hovelson D.H., Cani A.K., Liu C.J., McHugh J.B., Lucas D.R., Thomas D.G., Patel R.M, & Tomlins S.A. (2016). Targeted Next Generation Sequencing of CIC-DUX4 Soft Tissue Sarcomas Demonstrates Low Mutational Burden and Recurrent Chromosome 1p Loss. Human pathology, 58, 161-170.
+ Open protocol
+ Expand
3

GPR101 Genetic Variant Identification in Pituitary Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA was extracted from peripheral blood and pituitary tumor samples using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocols. The whole coding region of GPR101 was PCR amplified and directly sequenced. The following primers were used: GPR101_1AF: ACTGAGCCTGCAACCTGTCT; GPR101_1AR: TCCACTGACACCACGACAAT; GPR101_1BF: TTAGCCTCACCCACCTGTTC; GPR101_1BR: CTTCCTTCCTTGGCCTTCAG; GPR101_1CF: CAGCATGAAGGTGAGGTCAA; GPR101_1CR: CCCAGGGATAGCACATAGGA; GPR101_1DF: GTGCTACCAGTGCAAAGCTG; GPR101_1DR: TGAATTGTGGGTCCATTGAA. DNA sequencing was performed using the BigDye 3.1 Termination Chemistry (Applied Biosystems, Foster City, CA, USA) on a Genetic Sequencer ABI3500XL apparatus (Applied Biosystems). Sequences were visualized and aligned to the corresponding wild-type (WT) reference sequence using the SeqMan Pro software (DNAStar, Madison, WI, USA). All variants have been annotated according to Human Genome Variation Society (HGVS) recommendations (www.hgvs.org/mutnomen). The NM_054021.1 reference sequence was used to annotate GPR101 variants.
Trivellin G., Correa R.R., Batsis M., Faucz F.R., Chittiboina P., Bjelobaba I., Larco D.O., Quezado M., Daly A.F., Stojilkovic S.S., Wu T.J., Beckers A., Lodish M, & Stratakis C.A. (2016). Screening for GPR101 defects in pediatric pituitary corticotropinomas. Endocrine-related cancer, 23(5), 357-365.
+ Open protocol
+ Expand
4

Variant Identification in Ichthyosis Patients

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Pathogenic variants of ichthyosis patients were identified previously using Sanger sequencing or gene panel sequence analysis. For this study, genomic DNA was extracted from patient fibroblasts and hiPSCs with Genomic DNA Minikit (Invitrogen, Carlsbad, CA, USA), following the kit instructions. Primers for TGM1 exon 5, PNPLA1 exon 5 and ERCC2 exon 5 were designed with Primer 3 [46 (link)] (available upon request). PCR was performed using standard protocols. Products were purified and prepared for sequencing reaction with BigDye® Terminator v1.1 Kit (Applied Biosystems, Foster City, CA, USA) and run in a Sequence Analyser 3130XL (Applied Biosystems, Foster City, CA, USA). Sequences were analyzed with SeqmanPro software (DNASTAR Inc., Madison, WI, USA). Variant pathogenicity prediction was performed by in silico tools MutationTaster [47 (link)], SIFT [48 (link)], Polyphen-2 [49 (link)] and Human Splicing Finder 3.0 [50 (link)]. Variant novelty was accessed by searching ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/) and GnomAD v2.1.1 (https://gnomad.broadinstitute.org/).
Lima Cunha D., Oram A., Gruber R., Plank R., Lingenhel A., Gupta M.K., Altmüller J., Nürnberg P., Schmuth M., Zschocke J., Šarić T., Eckl K.M, & Hennies H.C. (2021). hiPSC-Derived Epidermal Keratinocytes from Ichthyosis Patients Show Altered Expression of Cornification Markers. International Journal of Molecular Sciences, 22(4), 1785.
+ Open protocol
+ Expand
5

Multiplex PCR for MPXV Lineage Typing

Check if the same lab product or an alternative is used in the 5 most similar protocols
All primers were developed by using Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast/) with default parameters. This software uses Primer3 to design the primers and then BLAST to determine specificity. We designed qualitative PCRs to detect the left and right short tandem repeats (STRs) at MPXV nucleotide positions 72–486 and 196710–197124, a region spanning the 625-bp deletion between bases 189820 and 190444 in the right ITR, and a 410-bp region of the CRS that contains 4 single-nucleotide polymorphism locations positively typing the lineages described in this article between nucleotide positions 89273 and 89944. All PCRs were run by using standard methods and optimized annealing temperatures of 55°C through 65°C. The PCR product Sanger sequences were aligned to the reference in SeqMan Pro software (DNAStar) for validation by using default parameters. Primer sequences are available on request.
Kugelman J.R., Johnston S.C., Mulembakani P.M., Kisalu N., Lee M.S., Koroleva G., McCarthy S.E., Gestole M.C., Wolfe N.D., Fair J.N., Schneider B.S., Wright L.L., Huggins J., Whitehouse C.A., Wemakoy E.O., Muyembe-Tamfum J.J., Hensley L.E., Palacios G.F, & Rimoin A.W. (2014). Genomic Variability of Monkeypox Virus among Humans, Democratic Republic of the Congo. Emerging Infectious Diseases, 20(2), 232-239.
+ Open protocol
+ Expand
6

Fluconazole-Resistant Candida tropicalis ERG11 Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Candida tropicalis isolates showing fluconazole resistance were subjected to ERG11 sequencing using a defined protocol [21 ]. The genome of C. tropicalis MYA-3404 (AAFN00000000.2) was considered the reference wild-type [22 (link)]. ERG11 sequences were analysed and curated by SeqMan Pro software (DNASTAR, Madison, WI, USA) and aligned by MEGA software v7.0 [23 (link)] in the presence of the wild-type sequence (AAFN00000000.2) (sequences available at the end of the Supplementary files).
Megri Y., Arastehfar A., Boekhout T., Daneshnia F., Hörtnagl C., Sartori B., Hafez A., Pan W., Lass-Flörl C, & Hamrioui B. (2020). Candida tropicalis is the most prevalent yeast species causing candidemia in Algeria: the urgent need for antifungal stewardship and infection control measures. Antimicrobial Resistance and Infection Control, 9, 50.
+ Open protocol
+ Expand
7

Phylogenetic Analysis of Bacterial Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sequences of 29 selected isolates were analyzed and forward and reverse sequence assembled by SeqMan Pro software (DNASTAR Inc., Madison, USA). Alignment of sequences and homologous sequences taken from GeneBank was performed with Clustal W 2.0 algorithm [26] . The phylogenetic tree was constructed by the maximum-likelihood algorithm using Jukes-Cantor distance correction and Bootstrap resampling method, all included in the MEGA7 package [27] . The tree was rooted using 16S rRNA gene sequence of Bacillus subtilis 168 (AL009126) as an outgroup. Sequences of nearest type strains, as well as, outgroup strain were taken from GenBank. 16S rRNA gene sequences (at least 1300 nt) were deposited in GeneBank under accession numbers MF11780-MF11807.
Spasic J., Mandic M., Radivojevic J., Jeremic S., Vasiljevic B., Nikodinovic-Runic J, & Djokic L. (2018). Biocatalytic potential of Streptomyces spp. isolates from rhizosphere of plants and mycorrhizosphere of fungi. Biotechnology and applied biochemistry, 65(6).
+ Open protocol
+ Expand
8

Fungal Strain Identification via DNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Strains were maintained on malt extract agar for 48 h at 25 °C. Genomic DNA was extracted according to Bolano et al.13 (link) with minor alterations. The internal transcribed spacers (ITS1 and ITS2, including the 5.8S gene) and the D1/D2 region of the large subunit ribosomal DNA (LSU rDNA) were amplified and sequenced per methods described previously by Cendejas-Bueno et al.14 (link) The sequences were trimmed and assembled, and consensus sequences were created with SeqMan Pro software (Version 9.0.4, 418, DNAStar Inc., Madison, WI, USA). The obtained sequences were compared with the available data in the NCBI database using the Basic Local Alignment Search Tool (BLAST).15 (link) Sequences of the studied strains and downloaded reference sequences from the BLAST search were aligned with MegAlign (DNAStar) using the Clustal W method.
Taj-Aldeen S.J., Almaslamani M., Theelen B, & Boekhout T. (2017). Phylogenetic analysis reveals two genotypes of the emerging fungus Mucor indicus, an opportunistic human pathogen in immunocompromised patients. Emerging Microbes & Infections, 6(7), e63-.
+ Open protocol
+ Expand
9

Sequencing of PDR1 and FKS1/2 Genes in C. glabrata

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR amplification and sequencing of the PDR1 gene and HS1/2 regions of the FKS1/2 genes were performed as previously described.29, 37 Sequences were assembled and edited using SeqMan Pro software (DNASTAR) and aligned using MEGA 7.0.38 The genome of Cglabrata CBS 138 (http://www.candidagenome.org) was used as a wild‐type reference.
Arastehfar A., Daneshnia F., Salehi M., Yaşar M., Hoşbul T., Ilkit M., Pan W., Hagen F., Arslan N., Türk‐Dağı H., Hilmioğlu‐Polat S., Perlin D.S, & Lass‐Flörl C. (2020). Low level of antifungal resistance of Candida glabrata blood isolates in Turkey: Fluconazole minimum inhibitory concentration and FKS mutations can predict therapeutic failure. Mycoses, 63(9), 911-920.
+ Open protocol
+ Expand
10

Targeted MED12 Mutation Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bi-directional Sanger sequencing was performed over the observed MED12 mutation hotspot (G44) on all tumor samples. Ten nanograms of genomic DNA was used as template in PCR amplifications with Invitrogen Platinum PCR Supermix Hi-Fi (Life Technologies, Foster City, CA) with the suggested initial denaturation and cycling conditions. Primer sequences were as previously reported (14 , 15 (link)) with the addition of universal M13 adaptors (M13 forward: TGTAAAACGACGGCCAGT and M13 reverse: CAGGAAACAGCTATGACC). PCR products were subjected to bidirectional Sanger sequencing for both primer pairs by the University of Michigan DNA Sequencing Core after treatment with ExoSAP-IT (GE Healthcare) and sequences were analyzed using SeqMan Pro software (DNASTAR, Madison, WI).
Cani A.K., Hovelson D.H., McDaniel A.S., Sadis S., Haller M.J., Yadati V., Amin A.M., Bratley J., Bandla S., Williams P.D., Rhodes K., Liu C.J., Quist M.J., Rhodes D.R., Grasso C.S., Kleer C.G, & Tomlins S.A. (2015). Next-Gen Sequencing Exposes Frequent MED12 Mutations and Actionable Therapeutic Targets in Phyllodes Tumors. Molecular cancer research : MCR, 13(4), 613-619.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!