To validate the putative miRNAs related to anthocyanin biosynthesis, eight miRNAs, including miR408a, miR172d, miR1432-5p, miR1425-5p, miR166g, miR827a, miR172b and miR165a-5p, were selected based on their corresponding DETFs. The primers for qRT-PCR experiments were designed using Primer 5.0 software, and the radish gene actin was used as a standard control (Table S2 ). First, using the One Step miRNA 1st cDNA Synthesis Kit (Shenggong, Chengdu, China), microRNA reverse transcription reactions were performed in an Eppendorf Mastercycler (Eppendorf North America, Westbury, NY, USA) for 60 min at 37 °C and for 5 min at 95 °C; the samples were then stored at 4 °C until further use. The RT-PCRs were performed in a 10 μL volume containing 1 μL of the diluted reverse transcription product, 1 µL of PCR buffer, 0.2 mM dNTPs, 2.0 U of EasyTaq DNA polymerase (TransGen Biotech, Beijing, China), 0.5 μM specific miRNA primer and 0.5 μM universal primer (5-TTACCTAGCGTATCGTTGAC-3) on an Eppendorf Mastercycler. The amplification programs were performed according to the standard protocol of the ABI7500 system in triplicate as described by Gao et al. (2015) (link). The relative quantitative method (2−ΔΔCT) was used to calculate the fold changes in the expression levels of target genes (Schefe et al., 2006 (link)).
Mastercycler
Manufactured by Eppendorf
Sourced in Germany, United States, China, United Kingdom, Canada, Australia, Japan
The Mastercycler is a thermal cycler instrument used for polymerase chain reaction (PCR) amplification of DNA samples. It provides precise temperature control and cycling parameters to facilitate the DNA replication process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (44 mentions)
Trizol, by Thermo Fisher Scientific (29 mentions)
Rneasy mini kit, by Qiagen (19 mentions)
Tri reagent, by Merck Group (13 mentions)
Iscript cdna synthesis kit, by Bio-Rad (13 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (13 mentions)
Taq polymerase, by Thermo Fisher Scientific (10 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (10 mentions)
Nanodrop, by Thermo Fisher Scientific (10 mentions)
Sv rna isolation, by Promega (9 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Sybr premix ex taq 2, by Takara Bio (7 mentions)
Sybr exscript qrt pcr kit, by Takara Bio (7 mentions)
Qiaquick pcr purification kit, by Qiagen (7 mentions)
Sybr green based detection, by Thermo Fisher Scientific (6 mentions)
Dneasy blood and tissue kit, by Qiagen (6 mentions)
Superscript 3 platinum sybr green one step qrt pcr kit, by Thermo Fisher Scientific (6 mentions)
M mlv reverse transcriptase, by Promega (6 mentions)
Rneasy kit, by Qiagen (6 mentions)
Gel documentation system, by Bio-Rad (6 mentions)
595 protocols using mastercycler
1
Validation of Anthocyanin-related miRNAs
2
Multilocus Sequence Typing of Acinetobacter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
International clonal (IC) types were determined based on the absence or presence of the alleles of csuE, ompA, and the intrinsic carbapenemase (blaOXA-51-like)-encoding genes in two multiplex PCRs, as previously described.27 (link) Identification of a strain as a member of Group 1 or Group 2 required the amplification of all fragments in the corresponding multiplex PCR and an absence of any amplification by the other multiplex PCR. Group 3 isolates were defined by the amplification of only the ompA fragment in the Group 2 PCR, and the amplification of only the csuE and blaOXA-51-like fragments in the Group 1 PCR. Isolates pertained to the novel variant of the PCR-based group, according to the new combination of amplified products. The amplification reaction was carried out by using a thermal cycler (Mastercycler Eppendorf, Germany) with an initial denaturation at 94°C for 3 min, followed by 30 cycles of 94°C for 45 s, 57°C for 45 s, and 72°C for 1 min. Besides, a final extension step was conducted at 72°C for 5 min. The MLST was also performed the previously described method by Bartual.28 (link) Primer sequences, sequence types (STs), allele sequences, clonal complexes (CCs), and other details are available in the MLST website at http://pubmlst.org
3
Amplification and Detection of pqqE Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total bacterial DNA was obtained by using the procedure described by Walsh et al.58 (link). The amplification of a 700 bp pqqE gene fragment was assayed using the primers F317 and R101936 (link). Moreover, the amplification of a ~ 350 bp pqqE gene fragment was analyzed using the primers pqqEENT1-(5ʹCCGAACAGTGGATTGAGGTT3ʹ) and pqqEENT2-(5ʹAATTCAGCACCATCGGGTAG3ʹ) designed for this study by multiple alignment of gene pqqE sequences obtained from NCBI gene data bank of bacteria belonging to the genera: Pantoea, Enterobacter, Klebsiella, Serratia and Erwinia. Each PCR reaction (20 μL) contained 2 μL (10 μM) of each primer, 2 μL (10X) of buffer, 2 μL (2 mM) of dNTPs, 7.4 μL of sterile bidistilled water, 2 μL of MgCl2 (50 mM), 0.2 μL of Taq DNA polymerase (5 U μL − 1) and 2.4 μL of template DNA. Amplifications were performed in a DNA thermal cycler (Mastercycler Eppendorf). The temperature profile for PCR-pqqE was: An initial cycle at 95 °C for 1 min, followed by 35 cycles at 94 °C for 1 min, at 55 °C for 1 min and at 72 °C for 2 min, and finally 72 °C for 10 min. Then, 10 μL PCR products were separated by horizontal electrophoresis on 1.2% (w v−1) agarose gels stained with SYBR Green II (Molecular Probes).
4
First-Strand cDNA Synthesis from Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First strand synthesis was performed using 3 µg of total RNA diluted in DEPC-treated H2O to obtain a final volume of 10 µL. 1 µL of 200 ng/µL oligo(dT) (5′-TTTTTTTTTTTTTTTTTTTTTV-3′; V = A or G or C; Sigma Genosys) was added to the samples, and samples were incubated in a thermocycler (Mastercycler Eppendorf) at 65 °C for 5 min, after which they were chilled on ice for 1 min. Samples were then incubated at 42 °C for 45-60 min in an Eppendorf thermocycler (Mississauga, ON, Canada) with 4 µL of 5× first strand buffer (Invitrogen), 2 µL of 0.1 M DTT (Invitrogen, Carlsbad, CA, USA), 1 µL of 10 mM dNTPs (BioShop, Burlington, ON, Canada), and 1 µL MMLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Serial dilutions of the cDNA were prepared and stored at 4 °C until use.
5
RNA Extraction and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of total RNA from treated and untreated cells was carried out using the illustra RNAspin mini® column (GE Healthcare, Bio-Sciences, Pittsburgh, PA, USA), according to the manufacturer’s instructions. Total RNA was treated with DNAse I (Invitrogen, Carlsbad, CA, USA) in order to remove contaminating genomic DNA. The RNA concentrations were determined using spectrophotometer Nanodrop® 2000c. The total RNA (250 ng) was reverse-transcribed with random primers and 200 IU M-MLV reverse transcriptase at 37 °C for 90 min, followed by 5 min of dissociation at 70 °C with Mastercycler Eppendorf®. The resulting cDNAs were diluted (1/10) and used as templates. Polymerase chain reaction (PCR) was performed in a Mx3005P QPCR system (Agilent Technology) with 5pmol of each primer set (Table 2 ) and iQTM SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) as follows: 95 °C for 5 min, followed by 40 cycles at 95 °C for 1 min, and annealing/extension at 60 °C for 60 s. Furthermore, S16 was used as an internal control. Positive standards and reaction mixtures lacking the reverse transcriptase were employed routinely as controls for each RNA sample. The relative quantification was calculated using the ΔΔCt method.
6
Cloning and Sequencing of Microbial Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All PCR reactions to clone or sequence IDF_13, IDF_15, ef2833, ef2847, ef2850, ef2169, and ef2170 genes were performed in a Mastercycler Eppendorf with Phusion high-fidelity DNA polymerase (NEB) and according to manufacturer’s instructions. PCR products and DNA restriction fragments were purified with QIAquick kits (QIAGEN, Hilden, Germany) when necessary. Electro-transformation of E. coli, L. lactis, and E. faecalis were carried out as previously described [64 (link),65 (link)] using a Gene Pulser apparatus (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Transformations of chemically competent E. coli ER2566 were carried out by a heat shock procedure.
7
First-Strand cDNA Synthesis from Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligo-dT primer ligation and reverse transcription was performed as described previously [42 (link)]. In brief, first-strand synthesis was performed using 1 ug of total RNA diluted in autoclaved RNase-free water to obtain a final volume of 10 ul. One microliter of 200 ng/ul oligo (dT) (5′-TTTTTTTTTTTTTTTTTTTTTV-3′; V = A or G or C; Sigma Genosys) was added to the samples, and samples were incubated in a thermocycler (Mastercycler Eppendorf) at 65 °C for 5 min, after which they were chilled on ice for 5 min. Samples were then incubated at 42 °C for 45–60 min in an Eppendorf thermocycler (Mississauga, ON, Canada) with 4 μl of 5× first-strand buffer (Invitrogen, Carlsbad, CA, USA), 2 μL of 0.1 M DTT (Invitrogen, Carlsbad, CA, USA), 1 μl of 10 mM dNTPs (BioShop, Burlington, ON, Canada), and 1 μl MMLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Serial dilutions of the cDNA were prepared and stored at 4 °C until use.
8
RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA from treated and untreated cells was performed using the Illustra RNAspin mini® column (GE Healthcare, Bio-Sciences, Pittsburgh, PA, USA) according to the manufacturer’s instructions. Total RNA was treated with DNAse I (Invitrogen, Carlsbad, CA, USA) to remove contaminating genomic DNA. The RNA concentrations were determined with spectrophotometer Nanodrop® 2000c. Total RNA (250 ng) was reverse-transcribed with random primers and 200 IU M-MLV reverse transcriptase at 37 °C for 90 min, followed by 5 min of dissociation at 70 °C with Mastercycler Eppendorf®. The resulting cDNAs were diluted (1/10) and used as templates. PCR performed in Mx3005P QPCR system (Agilent Technology, Santa Clara, CA, USA) with 5 pmol of RASSF1 primer sets as follows: Forward (F): GGG GTC GTC CGC AAA GGC C and Reverse (R): GGG TGG CTT CTT GCT GGA GG. Actin was used as an internal control. Forward (F): CAA CCG TGA AAA GAT GAC CCA G and Reverse (R): ATG GGC ACAGTG TGG GTG AC.
9
Identification of Acinetobacter baumannii by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From July 2011 to January 2013, a total of 124 non-duplicated A. baumannii isolates were collected from various clinical specimens in two teaching hospitals in Ahvaz, south-est of Iran. Bacterial isolates were initially identified as A. baumannii by biochemical tests (13 ). Suspected isolates were confirmed by PCR to identify blaOXA-51-like gene with specific primers (listed in Table 1 ) to amplify a 353 base pair sequence (14 (link)). DNA template for PCR was obtained by boiling method (15 (link)). Each reaction was carried out in a final volume of 25 µL containing 1x PCR buffer, 1 U Taq polymerase, 1.5 mM MgCl2, 200 µM of dNTP (SinaClon, Iran), 10 pmol of each primer (Eurofins MWG Operon, Germany) and 1 µL of the extracted DNA. PCR conditions were programmed in Mastercycler Eppendorf (Eppendorf, Germany) as follows: Initial denaturation at 94°C for 3 minutes; 35 cycles of 94°C for 45 seconds, annealing 57°C for 45 seconds, extension 72°C for 1 minute and final extension 72°C for 5 minutes. PCR products were separated on 1.5% agarose gel (SinaClon, Iran) by electrophoresis, stained with ethidium bromide (SinaClon, Iran) and then visualized under UV illumination (Syngene GeneGenius gel documentation system). Acinetobacter baumannii ATCC 19606 was used as positive control (14 (link)).
10
PCR Detection of pdhC and glyRS Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All of the N. lactamica and M. catarrhalis isolates were tested by PCR for the presence of pdhC (6 (link)) and glyRS (20 (link)) genes; respectively. To evaluate glyRS gene, the primers previously described by Post et al. were used, and to evaluate pdhC gene, newly designed primers were applied (Table 2 ). Primers were purchased from TAG Copenhagen A/S, Denmark. In each assay, the final 25 μL reaction mixture contained 2.5 μL of the 10× reaction buffer; 1 μL of 50 mM MgCl2; 0.5 μL of 2.5 mM dNTPs; 0.5 μL of each primer (20 pmol/μL); 0.2 μL Taq polymerase (5 U/μL); and 18.8 μL sterile distilled water. The PCR assays were performed in a Mastercycler Eppendorf (Eppendorf, Germany). Amplicons were analyzed by electrophoresis on a 1.5% agarose gel. PCR products were visualized and photographed under ultraviolet illumination. All the chemical materials used in this study were purchased from CinnaGen, Iran. Two reference strains were used as controls: N. lactamica (ATCC 23970) and M. catarrhalis (ATCC 25240). The results were analyzed using the SPSS software version 19.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!