M mlv reverse transcriptase

To evaluate gene expression, total RNA was extracted using an easy-BLUE RNA extraction kit (Intron). Total RNA (2 μg) was reverse-transcribed using M-MLV reverse transcriptase (ELPIS Biotech, Daejeon, Korea). Aliquots of the reverse-transcribed mixture were subjected to PCR using specific primer sets as follows: AdipoR1, forward 5'-CTTCTACTGCTCCCCACAGC-3' and reverse 5'-ACAAAGCCCTCAGCGATAG-3'; AdipoR2, forward 5'-CTTCTACTGCTCCCCACAGC-3' and reverse 5'-ATGGCCAGCCTCTACATCAC-3'; and GAPDH (control), forward 5'-CGCTCTCTGCTCCTCCTGTT-3' and reverse 5'-CCATGGTGTCTGAGCGATGT-3'.

Total RNA was isolated from tissues using RNA mini kit (Ambion) and 4 μg was reverse-transcribed with moloney-murine leukaemia virus (M-MLV) reverse transcriptase (ELPIS biotech). qRT-PCR was performed on Applied Biosystems StepOne with SYBR Green real-time PCR master mix (Applied Biosystems) according to the manufacture’s protocol. Actin was used as an internal control. Each sample was examined in triplicate. The relative expression levels of mRNA were determined by normalizing with internal controls and calculated by using the comparative Ct method. The following primer sequences were used: Crif1 (5′-GCGAAAGCAGAAGCGAGAAC-3′, 5′-GGCCCTCCGCTCCTTGT-3′), Axin2 (CCCTCCGGCAGCTATGAA, GGAGAGGTGGTCGTCCAAAA), Lef1 (5′-AGGGCGACTTAGCCGACAT-3′, 5′-TGCTGGCTGGGATGATTTC-3′), Actin (5′-CGATGCCCTGAGGCTCTTT-3′, 5′-TGGATGCCACAGGATTCCA-3′).

XylB transcripts were measured by quantitative PCR (qPCR) using rpoA as a reference. The total RNA of the VXA38D and VXA38C strains in the mid-log phase were extracted using a Ribospin II kit (GeneAll, Seoul, Korea). Complementary DNA of rpoA and xylB mRNA for each sample was synthesized using M-MLV Reverse Transcriptase (Elpis-Biotech, Daejeon, Korea) and rpoA_RT_R and xylB_RT_R primers. qPCR was performed in technical triplicates using TOPreal™ qPCR 2 × PreMIX (SYBR Green with high ROX) (Enzynomics, Daejeon, Korea) and rpoA_RT_F/R and xylB_RT_F/R primer sets, designed to amplify 200 bp regions of each gene (Additional file 1: Table S10). A StepOnePlus Real-time PCR system (Applied Biosystems, Foster City, CA, USA) was used for amplification and signal detection. To determine the relative transcript amount, the comparative CT method (2^−ΔΔCT) was utilized [71 (link)].

cDNA for LC3B was obtained by reverse transcription-polymerase chain reaction (RT-PCR). Briefly, total RNA was isolated from keratinocytes using an easy-BLUE RNA extraction kit (Intron, Daejeon, Korea), after which 2 μg of total RNA was reverse-transcribed with the Moloney-murine leukemia virus (M-MLV) reverse transcriptase (Elpis Biotech, Daejeon, Korea). An aliquot of RT mixture was then subjected to PCR amplification using a primer set for LC3B (5′-GTACGGATCCATGCCGTCGGAGAAGACCTT and 5′-AATTCTCGAGTTACACTGACAATTTCATCC). The amplified full-length cDNA for LC3B was then subcloned into the pENT/cytomegalovirus-green fluorescent protein (GFP), and replication-incompetent adenoviruses were created as reported previously [16 (link)]. For monitoring autophagy, the cells were transduced with adenovirus expressing GFP-LC3B overnight, after which the cells were replenished with fresh growth medium and incubated for an additional 24 h. After treatment with poly (I:C), autophagy was monitored by observation of LC3 puncta under the fluorescent microscopy.

Total RNA was isolated using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. Complementary DNA was synthesized using M-MLV reverse transcriptase (ELPIS Biotech) at 42°C for 1 h. The mixture was then boiled for 5 min to inactivate reverse transcriptase and quickly chilled on ice. Synthesized cDNAs were analyzed by real-time PCR using an EXPRESS SYBR GreenER (Invitrogen) kit on an IQ5 Real-Time PCR detection system (BioRad). Each value was normalized to 18S rRNA levels.