Superscript 4 vilo master mix

To quantify transcript levels of PAD1, parasites were grown to a density of 190,000 cells/mL for low-density samples or ≥1 million cells/mL for high-density samples. RNA was extracted from low- or high-density parasite populations using RNA Stat-60 (Tel-Test) following the manufacturer’s protocol and quantified on a NanoDrop 2000c. A 2.5-μg amount of RNA was used to generate cDNA using SuperScript IV VILO master mix (Fisher Scientific; 11756050) according to the manufacturer’s protocol. cDNA was amplified using 2× SYBR green master mix (Life Technologies 4309155) and primers and quantified on an Eppendorf Realplex2 instrument. For PAD1, the primers used were GACCAAAGGAACCTTCTTCCT and CACTGGCTCCCCTAAGCT, and for URA3, the primers used were CGGCAGCAGTTCTCGAGT and TGGCGTGTACCTTGAGGC. For differentiation experiments, the primers used for EP1 were TCTGCTCGCTATTCTTCTGTTC and CCTTTGCCTCCCTTAGTAAGAC, and for Tb927.10.9400 SF1, the primers used were GGTATGGTTCATCAGGAGTTGG and CGTTAGCACTGGTATCCTTCAG.

RNA was extracted from the dissected SNc tissue using RNeasy mini kit (QIAGEN). cDNA was synthetized by using the SuperScript IV VILO Master Mix (Applied Biosystems) and preamplified for 10 cycles using TaqMan PreAmp Master Mix and pool of TaqMan Gene Expression Assays (Applied Biosystems). The resulting product was diluted and then used for PCR with the corresponding TaqMan Gene Expression Assay and TaqMan Fast Advanced Master Mix. Data were normalized to Hprt by the comparative CT (2-DDCT) method.
The following TaqMan probes were used for PCR amplification of hprt (Mm01318746_g1) and Mcu (custom made; up, ACATACCACGTACGGCCAC; low, ATGCTGCTCAATGCACAGT; probe, ACGCTGAACGACGTGAAGACCC) genes.
Experimental Ct values were normalized to hprt values using the following formula: ΔCt = Ct (Mcu) − Ct (hprt). The final expression levels were shown as ΔCt values.

Total RNA was obtained by homogenizing the samples in Qiazol Lysis Reagent, purified using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), and quantified spectroscopically using a Nanodrop 2000c Spectrophotometer (Thermo Fisher). Reverse transcription was performed utilizing SuperScript™ IV VILO™ Master Mix, and qRT-PCR was performed on the Applied Biosystems real-time PCR system using SYBR Green Reaction Mix. Relative expressions of SRY-box transcription factor 9 (SOX9), collagen type II alpha 1 chain (COL2), aggrecan (AGG), alkaline phosphatase, MMP-13, collagen type X (COL10), ADAMTS4 (ATS4), cannabinoid receptor 1, and cannabinoid receptor 2 (Table S2) were calculated and analyzed using the ΔΔCT method. Human ribosomal protein L13a (RPL13a) was used as housekeeping gene control.

Total RNA was isolated from cells using TRIzol reagent (Invitrogen), according to the manufacturer's instructions. Portions (1 mg) of the DNase I‐treated RNA were subjected to reverse transcription (RT) with the use of SuperScript™ IV VILO™ Master Mix (Applied Biosystems). The reverse transcripts were used as templates for analysis of gene expression levels using a PX2 thermal cycler and TaKaRa Ex Taq (Takara Bio), according to the manufacturer's instructions. The following primer sets were used for hepatic markers: Foxa2 (forward 5'‐GGAGCCGTGAAGATGGAA‐3', reverse 5'‐CGCCCACACATAGGATGACA G‐3'); Hnf4a (forward 5'‐GCGACTCTCTAAAACCCTTGC‐3’, reverse 5'‐TTCTTCCTCACGCTCCTCCT‐3'); Sall1 (forward 5'‐CACAAGAAACCCAAGTGGCG‐3', reverse 5'‐GGACCACTGCGTTTGTGAAC‐3'); Alb (forward 5'‐CACCTTTCCTATCAACCCCACTA‐3', reverse 5'‐AGCAGTCAGCCAGTTCACCA‐3'); and Afp (forward 5'‐GGACTGCTCGAAACATCCCA‐3', reverse 5'‐TCTCGGCAGGTTCTGGAAAC‐3'). Primers for d‐glyceraldehyde‐3‐phosphate dehydrogenase (Gapdh) were used as an internal standard marker (forward 5'‐GGGAAGCTTGTCATCAATGG‐3', reverse 5'‐GTTGTCATGGATGACCTTGG‐3'). PCR conditions were as follows: 5 min at 94°C followed by 30 cycles of 30 s at 94°C, 30 s at 60°C and 1 min at 72°C, with a final elongation step of 5 min at 72°C. Aliquots of PCR product were analyzed on a 2% agarose gel containing Atlas ClearSight (Bioatlas).