Total mouse or human liver RNA was isolated with the commercial kit RNeasy Plus (QIAGEN, Valencia, CA). Reverse transcription with 1 µg RNA was carried out in an Eppendorf Mastercycler (Hamburg, Germany), using a high‐capacity complementary DNA reverse‐transcription kit (Thermo Fisher Scientific, Waltham, MA). Annealing of primers was done at 25°C for 10 minutes, followed by elongation at 37°C for 2 hours and inactivation of the enzyme at 85°C for 5 minutes. Negative controls with no added transcriptase were performed in parallel. Polymerase chain reaction (PCR) was performed in a 7500 Fast Real‐Time PCR System (ABI, Foster City, CA). Primers were purchased from Integrated DNA Technologies (Coralville, IA) with the sequences shown in Table 1 . PCR was carried out using Power SYBR Green Master Mix (Thermo Fisher Scientific). Taq polymerase was activated at 95°C for 10 minutes. The cycling parameters were denaturation at 95°C for 30 seconds and annealing and extension at 60°C for 1 minute (for 40 cycles). Data were analyzed using the 2−ΔΔCT method for relative quantification. STMN1 messenger RNA (mRNA) levels were normalized to those for glyceraldehyde‐3‐phosphate dehydrogenase.
High capacity complementary dna reverse transcription kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Spain
The High-capacity complementary DNA reverse transcription kit is a laboratory product designed for the synthesis of complementary DNA (cDNA) from RNA templates. This kit provides the necessary components, including reverse transcriptase enzyme, primers, and buffers, to efficiently convert RNA into single-stranded cDNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (12 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (12 mentions)
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Icycler system, by Bio-Rad (3 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (3 mentions)
Itaq universal sybr green supermix, by Bio-Rad (3 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (3 mentions)
Rneasy kit, by Qiagen (3 mentions)
Tri reagent, by Merck Group (3 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (2 mentions)
7900ht fast real time pcr, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
89 protocols using high capacity complementary dna reverse transcription kit
1
Quantitative Analysis of STMN1 mRNA
2
Quantification of miRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Thermo Fisher Scientific) was used to extract total RNA. Complementary DNA was synthesized using the High Capacity complementary DNA Reverse Transcription Kit (Thermo Fisher Scientific) following manufacturer’s instruction. PCR was performed in 96-well plates using SYBRGreen Master Mix (Thermo Fisher Scientific) on an iCycler system (Bio-Rad Laboratories Inc., Hercules, CA, USA). U6 small nuclear RNA was used as an internal control. Relative amounts of miRNA were normalized against U6 small nuclear RNA, and fold change for miRNA was calculated by the 2−ΔΔCt method. All the primers used in this study are described earlier.8 (link) The thermal conditions used for the real-time PCR were as follows: cycle 1, 95°C for 10 minutes; cycle 2 (×40), 95°C for 10 seconds and 58°C for 45 seconds.
3
Quantitative Analysis of Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time polymerase chain reaction was used to analyze the relative expression of target genes. Following the manufacturer’s instructions, RNA was isolated from human blood mononuclear cells using the RNeasy Fibrous Tissue Mini Kit (QIAGEN, Hilden, Germany), and complementary DNA was synthesized using the High-Capacity complementary DNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA). One microliter of complementary DNA, two microliters of forward and reverse primers, ten microliters of Fast SYBR Green Master Mix (Thermo Fisher Scientific), and eight microliters of nuclease-free water were added to a 20-microliter reaction mixture, which was then run through a real-time polymerase chain reaction system (Applied Biosystems, Foster City, CA) to quantify target genes by fluorescence. The primers used in quantitative real-time polymerase chain reaction were as follows: ITGB2, F 5’-ATGCTGGGCCTGCGCCC-3’, R 5’-GATGGTGTCACACTCGCAGTA-3’. STING1, F:5’- ATGCCCCACTCCAGCCTG -3’, R:5’- TCAAGCTGCCCACAGTAACCT -3’. ACTN1, F:5’-ATGGACCATTATGATTCTCAGCAAA-3’, R:5’-TTAGAGGTCACTCTCGCCGTA -3’. CCL5, F:5’-ATGAAGGTCTCCGCGGCAG-3’, R:5’-TCAAGGAGCGGGTGGGGTA-3’. HSPB1, F:5’- AGGAGTGGTCGCAGTGGTTAGG-3’, R:5’- CAGGGGACAGGGAGGAGGAAAC-3’. GAPDH, F:5’-ATCCCATCACCATCTTCC-3’ and R:5’-GAGTCCTTCCACGATACCA-3’.
4
Quantitative PCR Analysis of Liver Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary deoxyribonucleic acid (cDNA) was obtained by a reverse transcription of the RNA extracted using a high-capacity complementary DNA reverse-transcription kit (Thermo Fisher, Madrid, Spain). Quantitative polymerase chain reactions (qPCRs) were performed in 384-well plates in a 7900HT fast real-time PCR (Thermo Fisher, Madrid, Spain) using iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Barcelona, Spain). The thermal-cycle program used in all qPCRs was 30 s at 90 °C, 40 cycles of 15 s at 95 °C and 1 min at 60 °C. The analyzed liver genes were normalized by the housekeeping gene peptidylprolyl isomerase A (Ppia). The primers used for each gene were obtained from Biomers (Ulm, Germany) and can be found in Table 1 . The relative expression of each gene was calculated using the 2-∆∆Ct method, as reported by Schmittgen and Livak [38 (link)].
5
Liver Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA was obtained by a reverse transcription of the RNA extracted using a High-Capacity Complementary DNA Reverse Transcription Kit (Thermo Fisher, Madrid, Spain). The quantitative polymerase chain reactions (qPCRs) were performed in 384-well plates in a 7900HT Fast Real-Time PCR (Thermo Fisher, Madrid, Spain) using iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Barcelona, Spain). The thermal cycle used in all qPCRs was 30 s at 90 °C and 40 cycles of 15 s at 95 °C and 1 min at 60 °C. All liver genes were normalized by the housekeeping gene peptidylprolyl Isomerase A (Ppia). The primers used for each gene were obtained from Biomers (Ulm, Germany) (Table 1 ). The relative expression of each gene was calculated according to the Pfaffl method (2001) and normalized by the control group L12-STD-VH.
6
Quantitative Analysis of ACE2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from dissected colonic mucosa, stored in RNAlater using TRIzol reagent and purified with the Total RNA Purification Plus Kit (48300; Norgen Biotek) according to the manufacturer’s instructions. Total RNA was extracted from isolated and cultured colonic IECs using the Single Cell RNA Purification Kit (51800; Norgen Biotek). Complementary DNA for mRNA was generated from 500 ng of RNA using the High-Capacity Complementary DNA Reverse Transcription Kit (4368814; Thermo Fisher Science). Comparative-Ct-TaqMan with a relative quantification qPCR for mRNAs was performed on the QuantStudio 3 RT-PCR system using TaqMan Fast Advanced Master Mix (4444557; Thermo Fisher Science) with individual TaqMan probes (TaqMan Gene Expression assays, assay ID: Hs01085333_m1 [ACE2], Hs02339424_g1 [RPS9]). Expression of ACE2 was normalized to RPS9.
7
Quantifying RNA Levels in Lung Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol Reagent (15596018) from Thermo Fisher Scientific (Waltham, MA, USA) was utilized for the acquirement of total RNA of LAD tissues and surrounding healthy lung tissues as well as LAD cells. The MiRNA Reverse Transcription kit (4 366 597, Thermo Fisher Scientific) or High‐Capacity complementary DNA Reverse Transcription kit (4 374 967, Thermo Fisher Scientific) was employed for the synthesis of the first‐strand complementary DNA of miR‐363‐3p, XIST and MDM2, respectively. The SYBR Premix Dimer Eraser Kit (RR091A) from Takara (Dalian, China) was employed to carry out qRT‐PCR. The primers were exhibited as follows: glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) (F: 5′‐GAAGGTGAAGGTCGGAGTC‐3′, R: 5′‐GAAGATGGTGATGGGATTTC‐3′), U6 small nuclear RNA (snRNA) (F: 5′‐GCTCGCTTCGGCAGCACA‐3′, R: 5′‐GAGGTATTCGCACCAGAGGA‐3′),
XIST (F: 5′‐CAGACGTGTGCTCTTC‐3′, R: 5′‐CGATCTGTAAGTCCACCA‐3′), miR‐363‐3p (F: 5′‐GCCGAGAATTGCACGGTAT‐3′, R: 5′‐CTCAACTGGTGTCGTGGA‐3′) as well as MDM2 (F: 5′‐GAATCATCGGACTCAGGTACATC‐3′, R: 5′‐TCTGTCTCACTAATTGCTCTCCT‐3′). The levels of XIST, MDM2 and miR‐363‐3p were computed through 2‐ΔΔCt method, and GAPDH or U6 snRNA served as an internal control.
XIST (F: 5′‐CAGACGTGTGCTCTTC‐3′, R: 5′‐CGATCTGTAAGTCCACCA‐3′), miR‐363‐3p (F: 5′‐GCCGAGAATTGCACGGTAT‐3′, R: 5′‐CTCAACTGGTGTCGTGGA‐3′) as well as MDM2 (F: 5′‐GAATCATCGGACTCAGGTACATC‐3′, R: 5′‐TCTGTCTCACTAATTGCTCTCCT‐3′). The levels of XIST, MDM2 and miR‐363‐3p were computed through 2‐ΔΔCt method, and GAPDH or U6 snRNA served as an internal control.
8
Hypothalamic RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hypothalamus was processed to extract total RNA using TRIzol LS Reagent (Thermo Fisher, Madrid, Spain) followed by an RNeasy Mini Kit (Qiagen, Barcelona, Spain). RNA quantity and purity were measured with a NanoDrop 1000 spectrophotometer (Thermo Scientific, Madrid, Spain). RNA quality was assessed on a denaturing agarose gel. Reverse transcription was performed to obtain cDNA using the High-Capacity Complementary DNA Reverse Transcription Kit (Thermo Fisher). Gene expression was analyzed by quantitative PCR using the iTaq Universal SYBR Green Supermix (Bio-Rad) in the ABI prism 7900HT real-time PCR system (Applied Biosystems) using primers obtained from Biomers.net (Ulm, Germany). The forward and reverse primers used in this study can be found as Supplementary Table S5 . The relative expression of each gene was calculated referring to Ppia and Rplp0 housekeeping genes and normalized to the control group. The ∆∆Ct method was used and corrected for primer efficiency54 .
9
Quantitative RT-PCR Analysis of Pancreatic Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two μg of total RNA isolated from pancreatic cancer cells was used for cDNA synthesis using the High Capacity Complementary DNA Reverse Transcription Kit (Thermo Scientific) following manufacturer’s instructions. cDNA constructed was used as a template with SYBR Green Master Mix on an iCycler system (Bio-Rad, Hercules, CA) along with specific primer pair sets to perform qRT-PCR in 96-well plates. Supplementary Table 3 lists the sequences of the primers used, their respective Tm, and GC content. The thermal conditions employed for real-time PCR assays were as follows: cycle 1: 95 °C for 10 min, cycle 2 (×40): 95 °C for 10 sec and annealing temperature respective to each primer pair for 45 sec.
10
Quantitative Reverse-Transcription PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methods of quantitative reverse-transcription PCR were previously described20 (link),29 (link). For Raji and Jurkat clones, total RNA was extracted using the RNeasy kit (Qiagen) and first-strand complementary DNA was synthesized using the High-Capacity Complementary DNA Reverse-Transcription Kit (Thermo Fisher Scientific). Reverse-transcription PCR to detect each transcript was performed using primers shown in Supplementary Table 4 and FastStart Taq polymerase (Sigma-Aldrich, St. Louis, MO, USA). To achieve linear amplification, 21, 27, 29, and 31 cycles were found to be optimal in preliminary experiments for GAPDH, POU2AF1, COLCA1, and COLCA2, respectively. Quantitation of each transcript was performed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). These experiments were repeated 3 times with essentially identical results.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!