Esbl agar

Admission screening for multidrug-resistant organisms (MDRO) and clinical samples were processed according to the currently valid microbiological diagnostics standard using the BD Kiestra lab automation (36 (link)). Briefly, screening samples were plated onto extended-spectrum β-lactamase (ESBL) agar (bioMérieux GmbH, Germany) and additionally onto Columbia agar with 5% sheep’s blood to check for sampling validity by any bacterial growth on a nonselective universal culture medium for 24 h at 37°C. Species identification was performed using matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS; Bruker Daltonics, Germany). Antibiotic susceptibility testing was performed on the Vitek 2 (bioMérieux) and interpreted according to the EUCAST clinical breakpoints of the respective year of detection. The presence of carbapenemase was detected using an in-house PCR, as described elsewhere (37 (link), 38 (link)).

The plasmid was curated from Eco_b1 through prolonged incubation in ethidium bromide (EtBr 1%, AppliChem, Germany). Overnight cultures of Eco_b1 were suspended in PBS at McF of 1.0 diluted in PBS 1:10 000 and then 1:10 in LB broth (BioFroxx, Germany). EtBr was added in concentrations of 0.1–1 µg/mL and bacteria were incubated with shaking for 48 h. Vials displaying visual growth were diluted in PBS, plated on Columbia blood agar, incubated at 36 °C overnight and transferred onto both Columbia blood agar (BD, Germany) and ESBL agar (Biomérieux, Germany). After overnight incubation at 36 °C, bacterial colonies with phenotypic loss of resistance, as indicated by growth only on Columbia blood agar but not on ESBL agar, were subjected to PCR for hha to confirm removal of the hha-containing IncFII_1 plasmid. PCR for hha was carried out with Mytaq HS Polymerase Red (BioLine, meridian, USA) according to the manufacturer’s protocol. PCR was performed with the following primer sequences: hha fw ATGGCGAAAACAAAACAGGA, rev CCGGTGATTAATTCCGCTAA; and cycling conditions: 95 °C for 1 min, 30 cycles of: 95 °C for 15 sec, 60 °C for 15 sec, 70 °C for 10 sec. PCR products were visualized in 1.5% agarose gel.

Anorectal swab samples were collected as part of routine surveillance for multiresistant Gram negative rods. Samples were cultivated on chromID^® ESBL Agar (biomérieux, Marcy-l’Etoile, France), CHROMagar™ Acinetobacter (Mast Group, Paris, Frankreich), and Pseudomonas Cetrimide Agar (Thermo Fisher Scientific, Basingstoke, UK) and incubated at 36°C +/−1°C.