Sybr green pro taq hs premix

The primary hepatocytes were lysed using the AG RNAex Pro regent (Accurate Biotechnology (Hunan) Co., Ltd., Changsha, China) for 5 min at room temperature. Then, total RNA was extracted from the lysis using a SteadyPure RNA Extraction Kit with reference to the protocols provided by Accurate Biotechnology. Agarose gel electrophoresis was performed to confirm the quality of RNA samples with the purity determined by a Nanodrop UV spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Then, the first-strand complementary DNA (cDNA) was obtained by reverse transcription from 1 μg of total RNA using an Evo M-MLV RT Kit (Accurate Biotechnology (Hunan) Co., Ltd., Changsha, China). To quantify gene expression, the real-time PCR (RT-PCR) was conducted under the Bio-Rad CFX96 platform (Bio-Rad, Berkeley, CA, USA) using the SYBR Green Pro Taq HS premix acquired from Accurate Biotechnology. The 2^−∆∆Ct method was adopted to calculate the relative transcription with elongation factor 1α (ef1a) used as the housekeeping gene. The high expression stability of ef1a in M. amblycephala was demonstrated in a recent study [32 (link)]. Moreover, the sequences of primers used in the current study are listed in Table 1.

Total RNA was extracted with the aid of the TRIzol Reagent (Invitrogen, CA, USA) in accordance with the guidelines provided by the manufacturer. Reverse transcription was carried out in a 10 L reaction system utilizing Evo M-MLV RT Premix (Accurate Biotechnology, Hunan, China) as specified by the manufacturer. Real-time PCR was performed for the purpose of amplifying the cDNA using SYBR Green Pro Taq HS Premix (Accurate Biotechnology) and the Light Cycler 480 equipment (Roche Diagnostics, Basel, Switzerland). Relative quantification was performed using the 2^−△△Ct method. The relative expression levels of the target genes were standardized to GAPDH, and every sample was repeated thrice. The forward (F) and reverse (R) primers used were as follows: GAPDH-forward (F), TGGCCTTCCGTGTTCCTAC; GAPDH-reverse (R), GAGTTGCTGTTGAAGTCGCA; Acta2-F, TTCGTGACTACTGCCGAGC; Acta2-R, GTCAGGCAGTTCGTAGCTCT; FN-F, ACCTTGATCTCCCAAGCACG; FN-R, CGTCAGGTGCTGTAGTCTGT; FAP-F, GGATGGGCTGGTGGATTCTT; FAP-R, CCTCCCACTTGCCACTTGTA; CD206-F, ACGACAATCCTGTCTCCTTTGT; CD206-R, CAGATATGCAGGGAGTCACC; Arg-1-F, GGAACCCAGAGAGAGCATGA; Arg-1-R, TTTTTCCAGCAGACCAGCTT; S100A4-F, TCAGCACTTCCTCTCTCTTGG; S100A4-R, AACTTGTCACCCTCTTTGCC; and Inos-F, TCTAGTGAAGCAAAGCCCAACA; Inos-R, CTCTCCACTGCCCCAGTTTT.

Total mRNA was extracted using TRIzol reagent and reverse-transcribed into complementary DNA using the Evo Maloney murine leukemia virus reverse transcription Premix for qPCR (Accurate Biotechnology, Hunan, China). qRT-PCR analysis was performed using SYBR^® Green Pro Taq HS Premix (Accurate Biotechnology, Hunan, China) and LightCysler480 Real-Time PCR System (Germany). The primers for Fos, Cxcr5, and Actb were synthesized by Tsingke Biology (Beijing, China). The gene expression levels were analyzed using the 2^−ΔΔCt method. The expression levels of target genes were normalized to those of Actb. The primers used in qRT-PCR analysis are listed in Table 1.

The colorectal cancer cell line HCT116 and normal colon epithelial cell line NCM-460 were purchased from Fuheng Biotechnology (Shanghai, China). These cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, USA) with 10% fetal bovine serum (FBS) (Gibco, USA) and 1% penicillin-streptomycin in an atmosphere containing 5% CO2 at 37° C.
For RT-qPCR assay, we first extracted total RNAs from cells using AG RNAex Pro reagent (Accurate Biology, AG21102). After then, these RNAs were reverse transcribed into cDNA using Evo M-MLV Kit (Accurate Biology, AG11705). The cDNA was eventually used for RT-qPCR analysis using SYBR Green Pro Taq HS Premix (Accurate Biology, AG11701). All the reactions were performed in StepOnePlus™ instrument. The 2^-ΔΔCt strategy was applied to compute the relative mRNA level of genes. Human GAPDH was utilized to normalize expression levels. The sequences of the primers were as follows:
Human GAPDH: 5’- GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG-3’
COX17: 5’- GGTCGGGTCTCTGTTGACTT TTGCCGTTCTCCTCTCTCTC-3’
DLAT: 5’- CGGAACTCCACGAGTGACC CCCCGCCATACCCTGTAGT-3’

Total RNA from MSCs was extracted using TRIzol™ Reagent (Thermo Fisher, 15596-026) and reverse transcribed into cDNA using Evo M-MLV RT Master Mix [ACCURATE BIOTECHNOLOGY (HUMAN), AG11706, Changsha, China] according to the manufacturer's instructions. The cDNA was then used for RT-qPCR using SYBR® Green Pro Taq HS Premix (Accurate Biology, AG11701) on a real-time system (Bio-Rad, CFX96 Touch). The relative expression levels were analyzed using the 2^−ΔΔCtmethod with GAPDH as the reference gene. The primers used in this study are listed in Table S1.

To verify the temporal and spatial expression patterns of candidate genes, qRT-PCR was conducted with different rice organs of HJX74, including developing seeds at 20 and 30 DAF, mature roots, stems and leaves, and 3-day-old seedlings. Total RNA was isolated from the above tissues by using the RaPure Plant RNA Kit (Magen) according to the manufacturer’s instructions. First-strand cDNA was synthesized from the total RNA with the Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate biology). qRT-PCR was performed on a CFX 96 (Bio-Rad) in a 20 μl system containing 2 μl of cDNA, 0.4 μl of gene-specific primers (10 μM), 10 μl of SYBR Green Pro Taq HS Premix (Accurate biology), and 7.2 μl of RNase-free water according to the manufacturer’s protocol. The PCR program was 95 °C denaturation for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The specificity of the PCR amplification was checked with dissociation curves (65–95 °C) following the final cycle of the PCR. OsActin1 (Os03g0718100) was used as an internal reference for standardization of cDNA amounts. Primers for qRT-PCR are listed in Additional file 1: Table S2. Data represent three biological replicates and three technical replicates.

Quantitative PCR (qPCR) was performed to quantify the expression of uracil phosphoribosyltransferase [(UPRT) (TGGT1_312480)] gene and apicoplast gene (TGGT1_302050) between WT strain and ΔFabZ strain. The 18 s rRNA gene was used as an internal reference for normalization. The qPCR assay was performed as described previously (Wu et al., 2009 (link); Yeh and DeRisi, 2011 (link); Reiff et al., 2012 (link); Bansal et al., 2017 (link)). Genomic DNA was isolated from freshly egressed tachyzoites using Tiangen DNA extraction kit according to the manufacturer’s directions. The apicoplast and UPRT-specific gene sequences were amplified using Max Super-Fidelity DNA Polymerase (Vazyme). The amplification reaction mixture included 10 μl of 2 × SYBR Green pro Taq HS Premix (final concentration 1 ×) (Accurate Biology), 0.4 μl of 10 μM of each primer, 40 ng of the extracted T. gondii DNA, 0.4 μl of ROX Reference Dye, and sterile water to a final volume of 20 μl. qPCR was performed using an initial denaturation at 95°C for 30 s; followed by 40 cycles of amplification at 95°C for 10 s, 56°C for 20 s, and 72°C for 30 s.