Fetal bovine serum (fbs)

Primary fibroblast cultures were performed after patient’s skin biopsies. Control fibroblasts from a non-obese non-diabetic individual (strain 7095) were provided by the Centre de Ressources Biologiques Timone. Fibroblasts were cultivated in DMEM medium (Biowest, Nuaillé, France) supplemented with 15% fetal bovine serum (Eurobio, Courtaboeuf, France), 1% l-glutamine 200 mM (Life Technologies, Thermo Fisher Technologies) and 1% Penicillin-Streptomycin-Amphotericin (PAA Laboratory), in a culture flask of 25 cm² (SPL Life Sciences, Korea), under controlled atmospheric conditions (10% O₂, 5% CO₂, and 85% N₂) at 37 °C with 95% humidity.

Human carcinoma epithelial (HeLa) and human epithelial kidney (HEK-293T) cells were grown using standard procedures in 37 °C humidified incubator with 5% CO₂. All cell lines were grown in Dulbecco’s minimal essential medium (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (Eurobio).
Transfection was performed using Lipofectamine 2000 (Invitrogen) as indicated by the provider. For siRNA transfection, DharmaFECT1 (Thermo Scientific) was used according to the manufacturer’s instructions. The siRNA sequences used were:
RelAp43 siRNA: AGGAGCAGUGGAGAUGAAGACUCUUGG
Control siRNA: CCCACCGAUGGAGGACUUUCAAUUU
For viral infection, rabies virus (RABV) from Thailand (referred as Tha, isolate 8743 THA) and a vaccine strain SAD, that were previously described36 (link), were used. Cells were infected at a multiplicity of infection (m.o.i) of 1. To turn down endogenous RelAp43 expression in infected HeLa cells, control or RelAp43 siRNA were transfected as described above, 3 hours post infection.
When needed, 24 hours after transfection or infection, recombinant human TNF-α (R&D systems) was added (final concentration = 10 ng/ml) and incubated for indicated time at 37 °C.

Experiments were performed on six classical CTCL cell lines, including four cALCL: Mac1, Mac2A, Mac2B (DSMZ), and FEPD (Prof. G. Delsol, Toulouse, France); one T-MF: MyLa (Dr K. Kaltoft, Aarhus, Denmark); and one SS: Hut78 (ATCC). Furthermore, we included two SS cell lines newly developed in our laboratory: L1 and L2 [47 (link)]. A human T-cell leukemia cell line, 1301 (Sigma-Aldrich), was used as a positive control for the amplification of the hTERT RT domain splicing variants. The cells were cultured in an RPMI 1640 media (Gibco, Waltham, MA, USA) supplemented with 1% penicillin–streptomycin (Gibco) and 10% fetal bovine serum (Eurobio, Les Ulis, France), except for the L1 and L2 cell lines, which were cultured as previously described [47 (link)]. All cell lines were incubated at 37 °C with 5% CO₂ and regularly tested for mycoplasma contamination.

COS-7 cells from the ECACC purchased via Sigma-Aldrich, Acc Nc 87021302 were cultured in DMEM (Eurobio) supplemented with 1% glutamax (Thermo Fischer Scientific, #35050–038), 1% sodium pyruvate (Thermo Fischer Scientific, #11360–070), 10% Fetal Bovine Serum (Eurobio). Cells were thawed from frozen vials at passage + 4, and maintained up to passage 20. Cells were regularly tested negative for mycoplasma, using the MycoAlert detection kit (Lonza, #LT07-218). For streptavidin pull-down and Western blots, COS-7 cells were plated in 6-well plates (100,000 cells/well) and transfected the next day using X- tremeGENE 9 DNA (Transfection Reagent, Roche), with HA-NLGN1 + AP-MDGA1 or AP-MDGA2 + BirA^ER (total DNA 1 μg/well). Cells were left under a humidified 5% CO₂ / 37 °C atmosphere for 2 days before being processed for immunoprecipitation. For imaging experiments and shRNA validation experiments, cells were electroporated with the Amaxa system (Lonza) using the COS-7 ATCC program. Typically, 500,000 cells were electroporated with: 2 µg HA-MDGA1 or HA-MDGA2; 2, 4, 6 µg shMDGA1 or shMDGA2; and 2 µg HA-MDGA1 or HA-MDGA2 rescue. After 24 hr, cells were processed for imaging or biochemistry.

Opossum kidney cells (OKP cells) were maintained in DMEM (Gibco 42430) supplemented with 10% fetal bovine serum (Eurobio, Les Ulis, France), penicillin (100 U/mL), and streptomycin (100 U/mL) at 37 °C in a humidified atmosphere containing 5% CO₂. Human embryonic kidney (HEK) 293 cells were grown in DMEM media complemented with 10% fetal bovine serum and 1% penicillin/streptomycin. For plasmid DNA transfection, cells were grown to 60–70% confluence before being transiently transfected for 5 h using Lipofectamine plus kit according to manufacturer’s instructions (Invitrogen, Paris, France). For protein degradation experiments, cells were treated with MG132 (2 μM) or chloroquine (100 μM) 6 h prior to cell lysis, as previously described [53 (link),61 (link)]. Kifunensine (Sigma k1140, Saint-Quentin-Fallavier, France) was used at 25 µM 6 h before cell lysis.

Five CTCL cell lines were studied: Myla (T‐MF) (kindly provided by K. Kaltoft, Denmark), HuT78 (SS) (ATCC, Molsheim, France), and Mac1, Mac2A, and Mac2B (C‐ALCL) (DSMZ, Braunschweig, Germany). Cells were cultured in RPMI 1640 medium (Gibco, Gaithersburg, MD, USA) supplemented with 10% of fetal bovine serum (Eurobio, Les Ulis, France) and 100 U·mL⁻¹ of penicillin and streptomycin (Gibco).
Four SS patient‐derived cells (PDCs) obtained from four SS patients (patients 1 to 4) were also investigated. They were cultured as recently described by Poglio et al. [21 (link)].
Cell lines and PDC cultures were incubated at 37 °C in a humidified incubator with 5% CO₂.