HT-29 cells were transformed by clustered regularly interspaced short palindromic repeats endonuclease-mediated mutation with Cas9 2NLS nuclease (Synthego) and a synthetic guide RNA (Synthego) for human cytochrome p450 family 27 subfamily B member 1 (CYP27B1) (5′-GUGGUACUCUCGGUAGCCUA-3′). Transformations were performed by using Lipofectamine 3000 (Invitrogen) with Cas9 2NLS nuclease and synthetic guide RNA in Opti-Mem medium (Gibco). Mutagenesis was verified by Western blot analysis of the expressed CYP27B1 protein, 1α-OHase.
Cas9 2nls nuclease
Manufactured by Synthego
Cas9 2NLS nuclease is a gene editing enzyme developed by Synthego. It contains two nuclear localization signals (2NLS) to facilitate its transport into the cell nucleus. The core function of Cas9 2NLS nuclease is to introduce targeted double-strand breaks in DNA sequences, enabling precise genetic modifications.
Automatically generated - may contain errors
Lab products found in correlation
Gene pulser electroporation buffer, by Bio-Rad (2 mentions)
Gene pulser xcell electroporation system, by Bio-Rad (2 mentions)
Synthetic guide rna, by Synthego (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
P3 primary cell electroporation solution, by Lonza (1 mentions)
Nucleocuvette strip, by Lonza (1 mentions)
4d nucleofector, by Lonza (1 mentions)
Interleukin 2 (il 2), by Thermo Fisher Scientific (1 mentions)
Neon transfection system, by Thermo Fisher Scientific (1 mentions)
Nucleofector 2, by Lonza (1 mentions)
Nucleofector solution, by Lonza (1 mentions)
Inference of crispr edits, by Synthego (1 mentions)
Platinum taq dna polymerase high fidelity, by Thermo Fisher Scientific (1 mentions)
Lipofectamine crisprmax transfection reagent, by Thermo Fisher Scientific (1 mentions)
Sgrnas, by Synthego (1 mentions)
Cell line nucleofector kit 5, by Lonza (1 mentions)
Genejet genomic dna purification kit, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 glutamax medium, by Thermo Fisher Scientific (1 mentions)
Opti mem reduced serum medium, by Thermo Fisher Scientific (1 mentions)
11 protocols using cas9 2nls nuclease
1
Cas9-mediated CYP27B1 Mutation in HT-29 Cells
2
CRISPR-Cas9 Knockout of CD55 in Erythroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemically modified gRNA oligomers were synthesized by Synthego (Redwood City, CA, USA). The 20-nt-long specific sequences for targeting the CD55 gene were as follows: 5′-GGCGCGCCATGACCGTCGCG-3′ and 5′- GTTGTGCCTGCCGGCCGTGT-3′. 40 pmol of the Cas9 2NLS nuclease (Synthego) was complexed with 2 gRNAs (50 pmol each) to form RNPs for 10 min at room temperature prior to electroporation. After that, 0.2 × 106 BMI1-induced erythroblasts were reconstituted in P3 primary cell electroporation solution, according to the manufacturer’s instructions (Lonza, Basel, Switzerland) and mixed with RNP complexes. The supplemented cell solution was transferred into the Lonza 4D-Nucleofector with 20 μL Nucleocuvette strips and electroporated using the EO-100 program. Recovered cells were cultured for 72–96 h prior to flow cytometry analysis and erythroid terminal differentiation.
3
CRISPR-Cas9 Editing of DDX53 in iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Depending on the type of gene editing, guide RNA (gRNA) in DDX53 was identified by a CRISPR design tool (Benchling) (http://www.benchling.com ) (Additional file 1 : Table S1). Prior to nucleofection of the iPSCs with the CRISPR-Cas9 reagents, cells were treated with 10 μM Rho-associated, coiled-coil containing protein kinase (ROCK) inhibitor (RI) (Y-27632; StemCell Technologies) for 60 min at 37 °C, and dissociated in Accutase for 10–20 min. With 1.5 × 106 cells for the nucleofection reaction, we incubated 1.6 μl of 10 μM gRNA with 1 μl of 20 μM Cas9-2NLS Nuclease (Synthego) in 100 μl Human Stem Cell Nucleofection Solution 1 (Lonza) for 10 min at room temperature to form Cas9 RNP complexes. Afterwards, 5 μl of 10 μM single-stranded oligodeoxynucleotide (ssODN) was added to the complexes, and nucleofected the mix into 1.5 × 106 iPSCs using Nucleofector™2b (program A-023). After nucleofection, the cell solution was transferred onto the 96-well Matrigel-coated plate in mTeSRTM and 10 μM RI.
4
CARD8 Knockdown in CD3+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CD3+ T cells were thawed in RPMI-1640 medium supplemented with 10% FBS and cultured in RPMI-1640 medium supplemented with 10% FBS and 30-U/mL IL-2 (Peprotech). The cells were stimulated with CD3/CD28 Dynabeads for 48 h at 37 °C. To prepare RNP complex, 50 μM of CARD8 sgRNA (Synthego, sequence: U*G*C*ACCCCGCCGGCAAUUCA + Synthego modified EZ Scaffold) was mixed with 20-μM Cas9 2NLS nuclease (Synthego) and incubated at room temperature for 10 min. The cells were removed from Dynabeads, washed in 1× PBS, and resuspended to 6.6 × 107 cells/mL in buffer T from the Neon Transfection System kit. Ten microliter of cells were mixed with 1 μL of RNP complex and electroporated using the ThermoFisher Scientific Neon Transfection System at 1400 V, 10 ms, and three pulses. The cells were transferred in to a 24-well plate containing 1 mL of prewarmed culture media and was incubated for 48 h at 37 °C. The cells were pooled and incubated for 10 days before assaying for knockdown.
5
CRISPR/Cas9-Mediated Panx2 Knockout in Rat Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 technology was used to generate PANX2 KO REK cells (REK-PANX2KO) according to Synthego’s nucleofection CRISPR protocol. The CRISPRevolution single-guide RNA (sgRNA) EZ kit targeting the beginning of exon 2 of rat Panx2 gene (sequence: GCACAACUUCACCCGUGACC) and Cas9 2NLS nuclease were obtained from Synthego (Menlo Park, CA). One million cells/reaction were used for nucleofection with complexed ribonucleoprotein (9:1, sgRNA-to-Cas9 ratio) and Nucleofector solution L + supplement in a Nucleofector II (Amaxa Biosystems, Germany) according to the manufacturer’s instructions. Expansion and clonal selection were then performed postnucleofection and genomic DNA isolated for genome sequencing and analysis by Inference of CRISPR Edits (Synthego). Platinum Taq DNA High Fidelity polymerase (Invitrogen; REF#11304-011; Carlsbad, CA) was used for PCR to genotype the target region as per the manufacturer instructions using the following primers: Px2-F (5′-GGGGGTTCATTTGGGGAACA-3′) and Px2-R (5′-CAGGAAGTTGAGCTCGGAGG-3′). The genomic deletion was confirmed by Sanger sequencing provided by the London Regional Genomics Centre (Robarts Research Institute, London,ON, Canada).
6
Genetic Knockout of CaMKK2 in Breast Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
sgRNAs targeting specific sequences at the N-terminal end of the CaMKK2 gene were purchased from Synthego Corp. For each sgRNA, a ribonucleoprotein (RNP) complex was formed with the Cas9 2NLS nuclease (Synthego), at a sgRNA: Cas9 ratio of 6:1. MDA-MB-231-4175 cells were seeded at 8 × 104 cells/mL and transfected with the RNP complex using Lipofectamine CRISPRMAX transfection reagent (catalog #CMAX00008, Thermo Fisher Scientific). Five to 6 days posttransfection, cells were plated for single-cell isolation in 96-well plates at a limiting dilution of 0.6 cells/well. Single-cell clones were allowed to expand and clones with successful knockout of CaMKK2 were identified directly by immunoblotting. One random clone was selected for each of sgRNA #1, #2, and #3, as indicated, and used for experiments. The sequences of all sgRNAs used in the study are included in Supplementary Table SI.
7
CASP10 Gene Knockout in SW620 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KO of the CASP10 gene in SW620 cells was completed using the Gene Knockout Kit v2–Human CASP10 kit with Cas9 2NLS Nuclease (Synthego). Ribonucleoprotein (RNP) complexes were made at a 9:1 ratio of sgRNA:Cas9 (90 pmol:10 pmol) in Gene Pulser Electroporation Buffer (Bio-Rad, 1652677) and incubated for 10 min at RT. Cas9 control samples consisted of 10 pmol Cas9 with no sgRNA. RNP complexes were added to 200,000 cells in 200 µl electroporation buffer (0.2 cm cuvette) and electroporated via the Gene Pulser Xcell Electroporation System (Bio-Rad) using exponential decay pulses (145 V, 500 µF, 1000 ohm). Cells were immediately cultured in 12-well plates and allowed to recover for 7 days before measuring KO efficiency.
8
Generation of RAB27A/B Knockout Cells
9
CASP10 Gene Knockout in SW620 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Knockout of the CASP10 gene in SW620 cells was completed using the Gene Knockout Kit v2 -Human CASP10 kit with Cas9 2NLS Nuclease (Synthego). Ribonucleoprotein (RNP) complexes were made at a 9:1 ratio of sgRNA:Cas9 (90pmol:10pmol) in Gene Pulser® Electroporation Buffer (Bio-Rad, 1652677) and incubated for 10 min at RT. Cas9 control samples consisted of 10 pmol Cas9 with no sgRNA. RNP complexes were added to 200,000 cells in 200µL electroporation buffer (0.2 cm cuvette) and electroporated via the Gene Pulser Xcell™ Electroporation System (Bio-Rad) using exponential decay pulses (145V, 500µF, 1000ohm). Cells were immediately cultured in 12-well plates and allowed to recover for 7 days before measuring knockout efficiency.
10
CRISPR-Cas9 Genome Editing of MEP1A and MEP1B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For CRISPR-Cas9 genome editing, multiguide RNA (mgRNA) synthesized by Synthego targeting human MEP1A or MEP1B and recombinant Streptococcus pyogenes Cas9 nuclease 2NLS (Synthego) were used to generate isogenic MEP1A and MEP1B KO cells. Caco-2 cells were transfected with 300 pmol of mgRNA and 60 pmol of Cas9 by Amaxa nucleofection (program: CM-130, Lonza, Cologne, Germany) using the SF Cell Line 4D-Nucleofector X Kit S (Lonza Cologne AG, Cologne, Germany) according to the manufacturer’s instructions. Immediately after electroporation, single-cell seeding in 96-well plates was performed to obtain single-cell clones. Genotyping was performed on extracted genomic DNA (GeneJET Genomic DNA Purification Kit, Thermo Fisher Scientific) using DreamTaq PCR reagents (Thermo Fisher Scientific) and the following oligonucleotides: MEP1A−/−, 5′-CCCCATCTTTGGACCATTAGC-3′ (forward) and 5′-CCATTCCTTGAGGCCCTTATCT-3′ (reverse); MEP1B−/−, 5′-GACTAGGCAGTGGCGATTCTG-3′ (forward) and 5′-CCACAGACTCCGTTCCACATA-3′ (reverse).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!