The largest database of trusted experimental protocols

52 protocols using methanol

1

Synthesis of IWV Zeolite using Diquaternary Imidazolium OSDA

Check if the same lab product or an alternative is used in the 5 most similar protocols
IWV zeolite was synthesized using diquaternary imidazolium as an organic structure–directing agent (OSDA) (48 ). For the synthesis of OSDA, 24.8 g of 1,2,4,5-tetramethylimidazole (>98.0%, TCI) and 23.0 g of 1,5-dibromopentane (>97.0%; Sigma-Aldrich) were dissolved in 100 ml of methanol (>99.9%; Samchun Chemicals) and refluxed at 343 K overnight. Then, methanol was removed using a rotary evaporator, and the resulting product was recrystallized using 300 ml of diethyl ether (>99.0%; Samchun Chemicals). The precipitate was filtered, washed thoroughly with diethyl ether, and dried overnight at 323 K under vacuum. The resulting OSDA (Br form) was dissolved in deionized water and converted to OH form using Trilite MA-12OH ion-exchange resin (Samyang). The final concentration of OH-form OSDA was determined using a Mettler-Toledo DL22 autotitrator with 0.01 M HCl as titrant.
+ Open protocol
+ Expand
2

Fabrication of Serotonin Aptamer Biosensor

Check if the same lab product or an alternative is used in the 5 most similar protocols
3,4-Ethylenedioxythiophene (EDOT), polyacrylonitrile (PAN), dimethylformamide (DMF), ferric chloride, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), hexamethyldisilazane (HMDS), 3,4-Dimethoxythiophene, p-toluenesulfonic acid monohydrate (pTsOH·H2O), butylated hydroxytoluene (BHT), tetrahydrofuran (THF), and Sylgard 184 polydimethylsiloxane (PDMS) were obtained from Sigma–Aldrich. Ethanol, toluene, mEthanol, hexane (Hex), hydrochloric acid (HCl), and ethyl acetate (EtOAc) were obtained from Samchun. Sodium hydroxide (NaOH) was purchased from Daejung. (S)-Methyl 2,3-dihydroxypropanoate (Methyl glycerate) was purchased from Combi-Block. AZ5214E was obtained from Clariant. A serotonin aptamer with the sequence 5′-CGACTGGTAGGCAGAT AGGGGAAGCTGATTCGAGCGTGGGTCG[C6 Amine]-3′ was synthesized by Bioneer. Phosphate buffered saline (PBS) pH 7.4 (1 ×) was purchased from Gibco™, and simulated blood serum and artificial CSF were purchased from Biochemazone. All reagents and solvents were used as received without further treatment.
+ Open protocol
+ Expand
3

Superhydrophobic Fluorinated Silica Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tetraethyl orthosilicate (TEOS, 98%), 1H,1H,2H,2H-heptadecafluorodecyl methacrylate (FMA, 97%), (3-mercaptopropyl)trimethoxysilane (MPTMS, 95%), tetrahydrofuran (THF, ≥99%), and α,α,α-trifluorotoluene (TFT, ≥99%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Aerosil 200 was purchased from Evonic (Piscataway, NJ, USA). The γ-Butyrolactam (BL, 99%), 1,1,1,3,3-pentafluorobutane (≥99.5%), and anhydrous toluene (99.8%) were purchased from Alfa Aesar (Ward Hill, MA, USA). Anhydrous ethanol (99.9%), ammonium hydroxide solution (NH4OH, 28.0–30.0%), and methanol (99.8%) were purchased from Samchun (Yeosu, Korea). The TFT and THF were distilled under argon before use. Aerosil 200 was dried in a dry oven at 100 °C before surface modification. FMA and BL were purified by passing the liquid substances through a neutral alumina column to remove the inhibitor prior to use. The 2, 2′- azobisisobutyronitrile (AIBN, 99%) (Sigma–Aldrich, St. Louis, MO, USA) was purified by recrystallization in methanol.
+ Open protocol
+ Expand
4

Activated Carbon-based Membrane Fabrication

Check if the same lab product or an alternative is used in the 5 most similar protocols
Activated carbon (AC, MSP-20X) was purchased from Kansai Coke & Chemicals Co. (Hyogo, Kobe, Japan). Cationic- and anionic-exchange membranes were obtained from Fujifilm (Type 10, Tilburg, The Netherlands). Deionized water was produced using the Human Power II+ purification system (Human Corporation, Seoul, Korea). Multi-wall carbon nanotubes (CNTs) were obtained from Cheap Tubes Inc. (Grafton, VT, USA). Poly (vinylidene fluoride) (PVDF, Mw ~534,000 g/mol), Polyvinylpyrrolidone (PVP, Mw ~40,000 g/mol), and N-Methyl-2-pyrrolidone (NMP) were purchased from Sigma-Aldrich Inc. (St. Louis, MI, USA). Sodium chloride (99.5%) and methanol (99.9%) were purchased from Samchun Chemicals Co. (Seoul, Korea). 2-Methylimidazole (C4H6N2, 99%) and Cobalt (II) nitrate hexahydrate (Co(NO3)2·6H2O, 97.7%) were obtained from Thermo Fisher Scientific Co. (Ward Hill, MA, USA). All the chemicals were of analytical grade and were used as received from the suppliers without further purification.
+ Open protocol
+ Expand
5

Synthesis of Conjugated Polymers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sodium, FeCl3, 2-methyl-2-butanol, 2-ethyl hexyl bromide, Pd(PPh3)4, CuI, (i-Pr)2NH, ethynyltrimethylsilane, N-bromosuccinimide, 3,4-ethylenedioxythiophene, and 2,5-dibromothiophene were purchased from Sigma-Aldrich. DMF and 2-carbonitrile thiophene were purchased from Alfa Aesar Co. Tetrahydrofuran, dichloromethane, toluene, methanol, ethyl acetate, hexane, CHCl3, and potassium carbonate were purchased from Samchun Pure Chemicals. Tetrahydrofuran (THF), diethyl ether, toluene, and methylene chloride were used after distillation in the presence of Sodium/benzophenone or calcium hydride under nitrogen gas.
+ Open protocol
+ Expand
6

Antioxidant and Antimicrobial Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol, VA), glyceryl trioctanoate (tricaprylin, TCN), glyceryl tributyrate (tributyrin, TBN), 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,6-di-tert-butyl-4-methylphenol (BHT), Menhaden oil (MO), 1-butanol, and bacterial propidium iodide (PI) solution were purchased from Sigma-Aldrich Co. (USA). Acetone and toluene were purchased from Junsei Co. (Japan), while methanol was purchased from Merck Co. (Germany). methanol and HPLC grade water were purchased from Samchun Chemicals Co.(Korea), and methacrylate-divinylbenzene (MA-DVB) resin was purchased from GenoFocus (Korea). LB broth was purchased from Becton, Dickinson and Co. (USA).
+ Open protocol
+ Expand
7

Characterization of Hackberry Lipid Profiles

Check if the same lab product or an alternative is used in the 5 most similar protocols
The analytical standard reference material (C4-C24) of fatty acid methyl esters mixture, triacylglycerols (including glyceryl tripalmitoleate (tripalmitolein) , glyceryl tristearate, etc.) , sterols (including campesterol, beta-sitosterol, stigmasterol, stigmastanol, etc.) , 5-α-cholestane and 1-eicosanol were obtained from Sigma-Aldrich (America) . Chloroform, acetone, n-hexane, methanol and acetonitrile as HPLC grade solvents were ordered from Samchun Pure Chemical Co., Ltd (Gyeonggi, South Korea) . Potassium iodide (KI) , glacial acetic acid and n-propanol were purchased from Merck Company (Darmstadt, Germany) .
Hackberry fruits were collected from wild trees from village areas (Nodeh) in the northwest of Iran (Nowdeh, Khalkhal, Ardebil, Iran) . Khalkhal is located at 37.3481 latitude and 48.4453 longitude and it is situated at 1790 meters above sea level. Nowdeh have four season with, spring, cool summer (+20-+30℃) , autumn and cold winter / snowing (-10℃-+8℃) .
+ Open protocol
+ Expand
8

Polymer-Based Catalytic Nanocomposites

Check if the same lab product or an alternative is used in the 5 most similar protocols
PPO, azobisisobutyronitrile (12 wt % in acetone), and PEI (branched, molecular weight, ~800) were purchased from Sigma-Aldrich. N-bromosuccinimide (NBS; 98%), chlorobenzene (98%), FDA (GC grade 98%), EDA (99%), mmen (98%), and DETA (>98%) were purchased from TCI company. 1,2-Dichloroethane (99 + % grade) was purchased from Alfa Aesar. Iron(III) chloride anhydrous (FeCl3; 98%) was from Thermo Fisher Scientific. Chloroform (high-performance liquid chromatography grade, 99.8%) was purchased from Dae-jung Korea. Methanol (high-performance liquid chromatography grade, 99.90%) and ethanol (Extra Pure grade, 95%) were purchased from Sam-chun chemicals.
+ Open protocol
+ Expand
9

Immunostaining of Pluripotency and Lineage Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The iPSCs or embryoid bodies that spontaneously differentiated were grown in a suitable medium on glass coverslips placed in a 12-well plate. The grown cells were washed with 1× PBS; fixed and permeabilized in chilled methanol (Samchun Chemicals, Korea) for 10 min; washed with PBS; and blocked with a 3% BSA solution in PBS (Thermo Fisher Scientific, Inc.) for 30 min. After that, the cells were incubated with a primary antibody at 4°C overnight. The next day, the cells were rigorously washed and incubated with Alexa Fluor 488– or Alexa Fluor 546–conjugated secondary antibodies (Invitrogen, Carlsbad, CA, USA) for 1 h at room temperature. After a wash with PBS, nuclei were stained with a Hoechst 33258 solution (5 μM; Sigma-Aldrich) for 10 min. For staining of pluripotency markers of iPSCs, the following primary antibodies were used: anti-TRA1-60 (1 : 500; Abcam), anti-SSEA4 (1 : 500; Abcam), anti-OCT4A (1 : 1000; Cell Signaling Technology), and anti-NANOG (1 : 1000; Cell Signaling Technology). To detect germ layer markers of differentiation, the following primary antibodies were used: anti-AFP (for endoderm; 1 : 100; Santa Cruz Biotechnology), anti-SMA (for mesoderm; 1 : 250, Sigma), and anti-TUJ-1 (for ectoderm; 1 : 250; Abcam). All images were captured using the fluorescence microscope (Olympus IX53; Olympus Corporation, Tokyo, Japan).
+ Open protocol
+ Expand
10

Ovalbumin-Loaded Silica Nanoparticles for Immunotherapy

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rhodamine B isothiocyanate
(RITC), (3-aminopropyl)trimethoxysilane (APTMS), cethyltrimethylammonium
bromide (CTAB), ammonium hydroxide, tetraethylorthosilicate (TEOS),
and ovalbumin (OVA) were purchased from Sigma-Aldrich (St. Louis,
MO, USA). HCl, methanol, and ethyl acetate were purchased from SamChun
Chemical (Seoul, Korea). Bovine serum albumin (BSA) was purchased
from Millipore (Billerica, MA, USA), CpG oligodeoxynucleotide was
purchased from Bioneer (Daejeon, Korea). Recombinant murine GM-CSF
was purchased from Peprotech (Rocky Hill, NJ, USA). Antibodies against
the following proteins were used: CD11c-APC, MHC class-II-FITC, CD86-Vioblue,
MHC class-I(H-2Kb)/SIINFEKL-PE-Vio770, CD3e-FITC, CD4-PE-Vio770,
CD8-APC, IFN-γ-FITC, CD44-Vioblue, and CD62L-PE were purchased
from Miltenyi Biotec (Bergisch Gladbach, Germany) and H-2Kb/SIINFEKL tetramer-PE was purchased from MBL life science (Woburn,
MA). IL-12 and TNF-α ELISA kits were purchased from BD science.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!