RNA isolation of cohort 3 samples was performed on 300 μl CSF again using the miRCURY RNA Isolation kit for biofluids (Exiqon, Vedbaek, Denmark) according to the manufacturer’s protocol and including the on-column DNase treatment. To optimize RNA yield per sample, 2 μg glycogen carrier was added to the lysis solution. Secondly, to monitor RNA isolation and proper reference miRNA normalization, per sample, 150 pmol synthetic UniSP6 RNA spike-in (Exiqon) was added to the lysis solution. Eluted RNA was directly stored at − 80 °C.
Mircury rna isolation kit
The MiRCURY RNA Isolation Kit is a laboratory equipment product designed for the isolation and purification of RNA, including microRNA (miRNA), from a variety of sample types. The kit utilizes a convenient spin column-based method to efficiently extract and concentrate RNA molecules.
Lab products found in correlation
226 protocols using mircury rna isolation kit
CSF miRNA Isolation and Normalization Protocol
RNA isolation of cohort 3 samples was performed on 300 μl CSF again using the miRCURY RNA Isolation kit for biofluids (Exiqon, Vedbaek, Denmark) according to the manufacturer’s protocol and including the on-column DNase treatment. To optimize RNA yield per sample, 2 μg glycogen carrier was added to the lysis solution. Secondly, to monitor RNA isolation and proper reference miRNA normalization, per sample, 150 pmol synthetic UniSP6 RNA spike-in (Exiqon) was added to the lysis solution. Eluted RNA was directly stored at − 80 °C.
Exosomal miRNA Sequencing Protocol
Quantitative Analysis of miRNA and mRNA
RNA Extraction and qPCR Analysis
Comparative miRNA Expression in Rat Serum and Extracellular Vesicles
qRT-PCR Analysis of Brainstem Regions
Primers used for qRT-PCR.
Oligo name | Sequence |
---|---|
EP3alfa forward | GCTTCCAGCTCCACCTCCTT |
EP3 sense | 5′-TGACCTTTGCCTGCAACCTG-3′ |
EP3gamma forward | AGTTCTGCCAGGTAGCAAACG |
Efficient CRISPR-Cas9 Gene Editing in Diverse Cell Lines
Small RNA Extraction and Sequencing
Profiling miRNA in cell line and EVs
Quantifying miRNA Expression in hBMSCs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!