Mircury rna isolation kit

Manufactured by Qiagen

Sourced in Denmark, United States, Germany, Spain

The MiRCURY RNA Isolation Kit is a laboratory equipment product designed for the isolation and purification of RNA, including microRNA (miRNA), from a variety of sample types. The kit utilizes a convenient spin column-based method to efficiently extract and concentrate RNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

211 protocols using mircury rna isolation kit

CSF miRNA Isolation and Normalization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

CSF samples (0.5 ml) of cohorts 1 and 2 were spiked with 1 μg MS2 carrier RNA (Roche Applied Science) to increase the yield of RNA isolation [23 (link)]. Liquid was removed by freeze-drying on an Alpha 1–2 LDplys freeze dryer (Christ, Osterode am Harz, Germany) and samples were resuspended with 200 μl RNase-free water. RNA was isolated using the miRCURY RNA Isolation kit for biofluids (Exiqon, Vedbaek, Denmark). Equivalent CSF volumes were used as input for the RNA isolation. The expression profiles of miR-24 and miR-16 have been reported to be stable in several bodily fluids and tissues [24 (link)–27 ], and were therefore used for normalization purposes.
RNA isolation of cohort 3 samples was performed on 300 μl CSF again using the miRCURY RNA Isolation kit for biofluids (Exiqon, Vedbaek, Denmark) according to the manufacturer’s protocol and including the on-column DNase treatment. To optimize RNA yield per sample, 2 μg glycogen carrier was added to the lysis solution. Secondly, to monitor RNA isolation and proper reference miRNA normalization, per sample, 150 pmol synthetic UniSP6 RNA spike-in (Exiqon) was added to the lysis solution. Eluted RNA was directly stored at − 80 °C.

Bruinsma I.B., van Dijk M., Bridel C., van de Lisdonk T., Haverkort S.Q., Runia T.F., Steinman L., Hintzen R.Q., Killestein J., Verbeek M.M., Teunissen C.E, & de Jong B.A. (2017). Regulator of oligodendrocyte maturation, miR-219, a potential biomarker for MS. Journal of Neuroinflammation, 14, 235.

+ Open protocol

+ Expand

Exosomal miRNA Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exosomal RNA was isolated using a miRCURY RNA Isolation Kit (Exiqon) according to manufacturer’s protocol. Total RNA of each sample was used to prepare the miRNA sequencing library, which included the following steps: 1) 3′-adapter ligation; 2) 5′-adapter ligation; 3) cDNA synthesis; 4) PCR amplification; and 5) size selection of ~130–150 bp PCR amplified fragments (corresponding to ~15–35 nt small RNAs). The libraries were denatured as single-stranded DNA molecules, captured on Illumina flow cells, amplified in situ as clusters and finally sequenced for 36 cycles on Illumina HiSeq per the manufacturer’s instructions. The clean reads that passed the quality filter were processed to remove the adaptor sequence as the trimmed reads. Trimmed reads were aligned to the miRBase pre-miRNAs. miRNA read counts were normalized as tag counts per million miRNA alignments (TpM).

Lee W.H., Chen W., Shao N.Y., Xiao D., Qin X., Baker N., Bae H.R., Shukla P., Wu H., Kodo K., Ong S.G, & Wu J.C. (2017). COMPARISON OF NON-CODING RNAS IN EXOSOMES AND FUNCTIONAL EFFICACY OF HUMAN EMBRYONIC STEM CELL- VERSUS INDUCED PLURIPOTENT STEM CELL-DERIVED CARDIOMYOCYTES. Stem cells (Dayton, Ohio), 35(10), 2138-2149.

+ Open protocol

+ Expand

Quantitative Analysis of miRNA and mRNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cells using the miRCURY RNA Isolation Kit (Exiqon). cDNA was synthesized from small non-coding RNA using the miRNA RT assay (TaqMan). Expression levels of miRNA were measured on a 7900 fast RT-PCR system (Applied biosystems) in triplicates using 10 ng/µl cDNA and TaqMan probes specific for miR-138. U6 probe was used as an endogenous control. The ΔΔCt method was applied to determine the transcript abundance. For cDNA preparation from total mRNA, SuperScript III Reverse Transcriptase was used. Quantitative Real Time PCR (qRT-PCR) analyses were performed using primers that amplify a coding region of the TUSC2 gene. qRT-PCR was performed in triplicates with SYBR™ Green master mix (Applied Biosystems), 0.2 uM primers and 10 ng/µl cDNA. Adapted from Pascale et al.^{32 (link)}.

Nama S., Muhuri M., Di Pascale F., Quah S., Aswad L., Fullwood M, & Sampath P. (2019). MicroRNA-138 is a Prognostic Biomarker for Triple-Negative Breast Cancer and Promotes Tumorigenesis via TUSC2 repression. Scientific Reports, 9, 12718.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using the miRCURY RNA Isolation Kit from Exiqon (Vedbaek, Denmark) according to the manufactures description. RNA was reverse-transcribed using the masterscript kit purchased from 5prime (Hilden, Germany). Quantitative PCR analysis of CEBPε and GSF3R mRNA was performed using TaqMan® reagents and the StepOnePlus qPCR system (Applied Biosystems, Zug, Switzerland). Raw Ct values were normalized to HMBS and to the untreated control of day 3 (ΔΔCt method). Gene Expression Assays for CEBPE and CSF3R were HHs00357657_m1 and Hs00167918_m1, respectively (Applied Biosystems, Rotkreuz, Switzerland). HMBS primer and probes have been described previously [24 (link)].

Orfali N., O’Donovan T.R., Nyhan M.J., Britschgi A., Tschan M.P., Cahill M.R., Mongan N.P., Gudas L.J, & McKenna S.L. (2015). Induction of autophagy is a key component of all-trans-retinoic acid-induced differentiation in leukemia cells and a potential target for pharmacological modulation. Experimental hematology, 43(9), 781-93.e2.

+ Open protocol

+ Expand

Comparative miRNA Expression in Rat Serum and Extracellular Vesicles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood from five 3-month-old and five 24-month-old Fisher344 rats was collected from the orbital sinus. After centrifugation at 3000 × g for 15 min, 100 μl of serum was collected from the supernatant. Based on methods earlier described, BM-MSCs were extracted and cultured, and the derived MVs were collected from the 10 rats. Total RNAs in sera and MVs were extracted by using an Exiqon miRCURY RNA Isolation Kit. The corresponding cDNAs were synthesized by using SYBR PrimeScript miRNA reverse transcription-polymerase chain reaction (RT-PCR) Kit (Takara, Tokyo, Japan). Lastly, an ABI-Prism 7500 Sequence Detection System (Applied Biosystems, Waltham, MA, USA) and SYBR PrimeScript miRNA RT-PCR Kit (Takara) were used to detect the expression level of specific miRNAs (miR-344a, miR-294, miR-872-3p, miR-133b-3p, and miR-423-3p) and the loading control, miR-191.

Wang Y., Fu B., Sun X., Li D., Huang Q., Zhao W, & Chen X. (2015). Differentially expressed microRNAs in bone marrow mesenchymal stem cell-derived microvesicles in young and older rats and their effect on tumor growth factor-β1-mediated epithelial-mesenchymal transition in HK2 cells. Stem Cell Research & Therapy, 6, 185.

+ Open protocol

+ Expand

qRT-PCR Analysis of Brainstem Regions

Check if the same lab product or an alternative is used in the 5 most similar protocols

The preBötC and pFRG/RTN regions were cut out from brainstem slices with micro scissors. The samples were pooled together litterwise to minimize the effect of different tissue piece sizes, and provide enough cells for accurate analysis. RNA was isolated from the tissue samples using the miRCURY RNA isolation Kit (Exiqon) according to manufacturer’s instructions. cDNA was synthesized from 20 ng RNA using SuperScript VILO cDNA Synthesis Kit (Invitrogen). The reverse transcription was performed according to the manufacturer’s protocol. Real-time PCR was run with Power SYBR Green PCR Master Mix (Applied Biosystems) and amplified in a 7500 Real Time PCR system (Applied Biosystems). Primers are listed in Table 8. As endogenous control, glucose-3 phosphate dehydrogenase (GAPDH; Applied Biosystems) was used. Relative quantification (RQ) values were calculated using the CT^(ΔΔCT) method (Livak and Schmittgen, 2001 (link)).

10.7554/eLife.14170.066

Table 8.

Primers used for qRT-PCR.

DOI:http://dx.doi.org/10.7554/eLife.14170.066

Oligo name	Sequence
EP3alfa forward EP3alfa reverse	GCTTCCAGCTCCACCTCCTT CATCATCTTTCCAGCTGGTCACT
EP3 sense EP3beta anti-sense	5′-TGACCTTTGCCTGCAACCTG-3′ 5′-GACCCAGGGAAACAGGTACT-3′
EP3gamma forward EP3gamma reverse	AGTTCTGCCAGGTAGCAAACG GCCTGCCCTTTCTGTCCAT

Forsberg D., Horn Z., Tserga E., Smedler E., Silberberg G., Shvarev Y., Kaila K., Uhlén P, & Herlenius E. (2016). CO2-evoked release of PGE2 modulates sighs and inspiration as demonstrated in brainstem organotypic culture. eLife, 5, e14170.

+ Open protocol

+ Expand

Efficient CRISPR-Cas9 Gene Editing in Diverse Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

293T cells, iPSCs and iMSCs were transduced with Lenti-U6-sgCD73-SFFV-Cas9-2A-Puro vectors at an MOI of 0.3 in the presence of 8 μg/ml protamine sulfate. Two days after transduction, cells were treated with 0.5–1 μg/ml puromycin for ~1 week. At 10 days after transduction and puromycin selection, cells were harvested by treating with Accutase. Total RNA was extracted using miRCURY RNA Isolation Kit (EXIQON). Reverse transcription was performed using the EasyScript Plus cDNA Synthesis Kit (ABM), following the manufacturer’s instructions. Quantitative real-time RT-PCR (qPCR) was performed as previously described5 (link)50 (link). Expression of sgRNA and Cas9 was normalized to the expression of GAPDH. The sequences of primers for qPCR are as follows: sgRNA forward, AGCTAGAAATAGCAAGTTAAAATAAGG; reverse, GACTCGGTGCCACTTTTTCA; Cas9 forward, CCGAAGAGGTCGTGAAGAAG; reverse, GCCTTATCCAGTTCGCTCAG; GAPDH forward, GTGGACCTGACCTGCCGTCT; reverse, GGAGGAGTGGGTGTCGCTGT.

Zhang J.P., Li X.L., Neises A., Chen W., Hu L.P., Ji G.Z., Yu J.Y., Xu J., Yuan W.P., Cheng T, & Zhang X.B. (2016). Different Effects of sgRNA Length on CRISPR-mediated Gene Knockout Efficiency. Scientific Reports, 6, 28566.

+ Open protocol

+ Expand

Small RNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small RNA was extracted from EVs and total plasma with miRCURY RNA Isolation Kit (Exiqon, Qiagen). Libraries were prepared with NebNext Small RNA Library Prep (New England Biolabs, Ipswich, MA, USA). Quality control steps for libraries were performed on TapeStation (Agilent Technologies, Santa Clara, CA, USA) before and after size selection. cDNA concentration was measured using the Quantus fluorometer (Promega, Madison, Wisconsin, USA). Pooled libraries were sequenced with High Output v2.0 reagents on the NextSeq 500 sequencer (Illumina, San Diego, CA, USA).

Totoń-Żurańska J., Sulicka-Grodzicka J., Seweryn M.T., Pitera E., Kapusta P., Konieczny P., Drabik L., Kołton-Wróż M., Chyrchel B., Nowak E., Surdacki A., Grodzicki T, & Wołkow P.P. (2022). MicroRNA composition of plasma extracellular vesicles: a harbinger of late cardiotoxicity of doxorubicin. Molecular Medicine, 28, 156.

+ Open protocol

+ Expand

Profiling miRNA in cell line and EVs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell line RNA and EV RNA was collected using miRCURY RNA Isolation Kit (Exiqon). Seven hundred and forty-two miRNAs were measured using microRNA Ready-to-Use PCR, Human panel I+II (Exiqon) on a Viia 7 Real-Time PCR System (Thermo Fisher). Cell line and EV profiles were normalized to global mean and fold-change analysis was used to compare matched cellular and EV miRNA profiles [36 (link)]. We subsequently validated EV miRNA candidates using a TaqMan Assay normalized to input and cel-miR-39-3p miRNA spike in to account for PCR efficiencies.

Lawson J., Dickman C., MacLellan S., Towle R., Jabalee J., Lam S, & Garnis C. (2017). Selective secretion of microRNAs from lung cancer cells via extracellular vesicles promotes CAMK1D-mediated tube formation in endothelial cells. Oncotarget, 8(48), 83913-83924.

+ Open protocol

+ Expand

Quantifying miRNA Expression in hBMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qRT-PCR was used to determine the expression of miRNA-183, -96, and -182 in the hBMSCs after transfection. The RNA extraction was then carried out using miRCURY RNA isolation kit (Exiqon, Denmark) for 24 and 48 hours following cell transfection. Universal cDNA synthesis kit (Exiqon, Denmark) was similarly used for the synthesis of cDNA. The qRT-PCR was also performed via SYBR green master mix kit (Exiqon, Denmark), and specific primers were determined for miRNA-183, -96, and -182 (Exiqon, Denmark) Table 1. In addition, snord was employed as the internal control and the 2^−ΔΔCt method was used for data analysis in the qRT-PCR test. The qRT-PCR was then performed using the Rotor-Gene 6000 (Corbett, Australia) with the following thermal cycling profile: 95°C for 2 minutes, followed by 40 cycles of amplification (95°C for 5 seconds, 60°C for 30 seconds).

Mahmoudian-Sani M.R., Forouzanfar F., Asgharzade S, & Ghorbani N. (2019). Overexpression of MiR-183/96/182 Triggers Retina-Like Fate in Human Bone Marrow-Derived Mesenchymal Stem Cells (hBMSCs) in Culture. Journal of Ophthalmology, 2019, 2454362.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!