Log In Sign up
The largest database of trusted experimental protocols

Penter flag

Manufactured by Charles River Laboratories
Visit Supplier
Sourced in United States

The PENTER-FLAG is a laboratory instrument used for the detection and analysis of various biological samples. It is designed to provide accurate and reliable results for research and diagnostic applications. The core function of the PENTER-FLAG is to perform sensitive and precise measurements on samples, enabling researchers and clinicians to obtain valuable insights into their areas of study.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000, by Genechem (1 mentions) Ubi mcs 3flag cbh gcgfp ires puromycin vector, by Genechem (1 mentions) Puromycin, by Merck Group (1 mentions)

Close spelling variants of this product

PENTER-Flag control plasmid (2 citations) PENTER (22 citations)

6 protocols using penter flag

1

RUFY3 Overexpression Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human complementary DNA (cDNA) corresponding to the full-length RUFY3 was obtained by RT-PCR amplification. The PCR aliquots were subcloned into mammalian expression vector pENTER-FLAG (ViGene Biosciences, Rockville, MD, USA). Populations of pENTER vector alone and pENTER RUFY3 stable transfectants were obtained using the same plasmid and selection process as previously described19 . Viable clones were pooled, identified for RUFY3 expression by western blot and maintained in medium containing 600 μg/ml puromycin for additional studies.
Xie R., Wang J., Liu X., Wu L., Zhang H., Tang W., Li Y., Xiang L., Peng Y., Huang X., Bai Y., Liu G., Li A., Wang Y., Chen Y., Ren Y., Li G., Gong W., Liu S, & Wang J. (2017). RUFY3 interaction with FOXK1 promotes invasion and metastasis in colorectal cancer. Scientific Reports, 7, 3709.
+ Open protocol
+ Expand
2

Stable Cell Lines for SOX9 and COL10A1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human full-length SOX9 and COL10A1 complementary DNA (cDNA) was amplified by RT-PCR. The products were subsequently cloned into the expression vector of pEnter/Flag (Vigene Biosciences, Jinan, China). To establish stable cell lines, empty pEnter vector or pEnter-SOX9 or pEnter-COL10A1 were used to transfect GC cells. The transfected cells were passaged at 1:15 and selected in RPMI 1640 medium supplemented with puromycin (2 µg/ml) for 4 weeks. SOX9 and COL10A1 expression were assessed by western blot analysis.
Li T., Huang H., Shi G., Zhao L., Li T., Zhang Z., Liu R., Hu Y., Liu H., Yu J, & Li G. (2018). TGF-β1-SOX9 axis-inducible COL10A1 promotes invasion and metastasis in gastric cancer via epithelial-to-mesenchymal transition. Cell Death & Disease, 9(9), 849.
+ Open protocol
+ Expand
3

HOXD9 cDNA Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human complementary DNA (cDNA) corresponding to the full-length HOXD9 was obtained by RT-PCR amplification. The PCR products were subcloned into mammalian expression vector pENTER-FLAG (ViGene Biosciences, Rockville, MD, USA). Populations of pENTER vector and pENTER HOXD9 stable transfectants were obtained using the same plasmid and selection process. Cell transfection was performed with Lipofectamine TM 2000 (Invitrogen) as described in the manufacturer’s protocol.
Zhu H., Dai W., Li J., Xiang L., Wu X., Tang W., Chen Y., Yang Q., Liu M., Xiao Y., Zhang W., Lin J., Wang J., Liu G., Sun Y., Jiang P., Li G., Li A., Liu S., Chen Y, & Wang J. (2019). HOXD9 promotes the growth, invasion and metastasis of gastric cancer cells by transcriptional activation of RUFY3. Journal of Experimental & Clinical Cancer Research : CR, 38, 412.
+ Open protocol
+ Expand
4

Manipulating PBX2 and HOXA6 in GC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-PCR amplification was carried out to prepare normal human cDNA with related to the full-length PBX2 or HOXA6. Thereafter, the PCR products obtained were further cloned to pENTER-FLAG or pENTER-HA mammalian expression vector (Vector, Vigene Biosciences, Rockville, MD, USA). Next, stable GC cell lines with ectopic HOXA6 or PBX2 expression were established using Lipofectamine TM 3000.
Lentiviruses expressing EGFP/HOXA6 (LV-HOXA6) were synthesized by GeneChem (Shanghai, China) by the use of Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin vector, whereas the corresponding empty vector served as internal reference (Shanghai GeneChem Co, Ltd, China).
The double-stranded oligonucleotides that encoded human HOXA6-vshRNA (NM_024014: HOXA6 shRNA 2: CCGGAGGAAAACAAGCUCAUCAATCAAGAGUUGAUGAGCUUGUUUUGGUTTTTTG) or PBX2-vshRNA (NM_002586: PBX2 shRNA 2: CCGGCAUCGAACACUCGGACUAUUCAAGAGGUAGCUUGUGAGCCUGAUAUUUUG) were annealed and inserted into the U6-MCS-Ubiquitin-Cherry-IRES-puromycin short hairpin RNA (shRNA) expression vector. The selective overexpression or knockdown cells were applied in later analysis.
Lin J., Zhu H., Hong L., Tang W., Wang J., Hu H., Wu X., Chen Y., Liu G., Yang Q., Li J., Wang Y., Lin Z., Xiao Y., Dai W., Huang M., Li G., Li A., Wang J., Xiang L, & Liu S. (2021). Coexpression of HOXA6 and PBX2 promotes metastasis in gastric cancer. Aging (Albany NY), 13(5), 6606-6624.
+ Open protocol
+ Expand
5

Constructing HMGA1 Stable Cell Lines

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human complementary DNA (cDNA) corresponding to full-length HMGA1 (HMGA1 variant 1) was acquired by RT-PCR. Then the products of PCR were subcloned into the vector pENTER-FLAG (ViGene Biosciences, Rockville, MD, USA). The AGS and BGC-823 lines were transfectants with pENTER vector and pENTER HMGA1vector to construct the stable cells line [30 (link), 31 (link)].
Yang Q., Wang Y., Li M., Wang Z., Zhang J., Dai W., Pei M., Hong L., Xiao Y., Hu H., Li J., Lin J., Wu X., Chen Y., Huang M., Li A., Liu S., Tang W., Xiang L, & Wang J. (2021). HMGA1 promotes gastric cancer growth and metastasis by transactivating SUZ12 and CCDC43 expression. Aging (Albany NY), 13(12), 16043-16061.
+ Open protocol
+ Expand
6

Stable Expression of CCDC43 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human complementary DNA (cDNA) corresponding to the full-length CCDC43 was obtained by RT-PCR amplification described previously [19, 20] . The PCR aliquots were subcloned into the mammalian expression vector pENTER-FLAG (ViGene Biosciences, Rockville, MD, USA).
To establish stable cell lines, cells transfected with empty pENTER vector and pENTER-CCDC43 were passaged at 1:15 (vol/vol) and cultured in RPMI 1640 medium supplemented with puromycin (Sigma, St. Louis, MO, USA) at 2 µg/ml for 4 weeks.
Wang J., Liu G., Liu M., Xiang L., Xiao Y., Zhu H., Wu X., Peng Y., Zhang W., Jiang P., Li A., Nan Q., Chen Y., Chen C., Cheng T., Liu S, & Wang J. (2018). The FOXK1-CCDC43 Axis Promotes the Invasion and Metastasis of Colorectal Cancer Cells. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(6).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!