TRIzol reagent was used to extract total RNA from target cells. PrimeScript RT Kit (Takara Bio, Japan) was used to reverse transcribe 10 μL of DEPC water (Invitrogen) into cDNA from the precipitate after centrifugation at 12,000 × g (4°C; 10 min) and supernatant was adsorbed and disposed of. With an Applied Biosystems® 7500 Real-Time PCR (California, USA) and the Takara SYBR® Premix Ex TaqTM II kit, RT-qPCR analysis was carried out. The following temperatures were used for PCR experiments: 95°C for 10 minutes, 55°C for 2 minutes, and 72°C for 2 minutes. These were followed by 40 cycles of 95°C for 15 s and 60°C for 32 s. The sequences of the primer pairs are listed in Table 3
7500 real time pcr
Manufactured by Takara Bio
Sourced in United States
The 7500 Real-Time PCR is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of accurately detecting and quantifying target DNA sequences in real-time during the amplification process. The 7500 Real-Time PCR features a 96-well format, advanced thermal cycling capabilities, and high-performance optical detection system to facilitate precise and reliable nucleic acid quantification.
Automatically generated - may contain errors
Lab products found in correlation
Primescript 1st strand cdna synthesis kit, by Takara Bio (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Sybr premix ex taqtm 2 kit, by Takara Bio (1 mentions)
Depc water, by Thermo Fisher Scientific (1 mentions)
Trizol agent, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
4 protocols using 7500 real time pcr
1
Gene Expression Analysis via RT-qPCR
2
Quantitative PCR Analysis of HE4 and EGFR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time polymerase chain reaction (qRT-PCR) assays were performed on Applied Biosystems 7500 Real-Time PCR (Carlsbad, CA, USA) using SYBR Premix Ex Taq™ (Takara) after cDNA was synthesized using PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Beijing, China). The levels of HE4 mRNA were calculated by the 2−ΔΔCT method and GAPDH was used as an internal control. The qRT-PCR assays were carried out using the following primers: HE4 primers were purchased from Gene Copoeia (#HQP000481, Guangzhou, Guangdong, China). GAPDH primer sequences have been reported in our previous study [32 (link)]. EGFR sense: AGCAGAGACCCACACTACCA; EGFR anti-sense: GTAGTCAGGGTTGTCCAGGC.
3
Quantitative Analysis of HE4 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from tissue and cell samples using Trizol agent (Invitrogen) and cDNA was synthesized using PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Dalian, China). Then, qRT-PCR assays were performed on Applied Biosystems 7500 Real-Time PCR using SYBR Premix Ex Taq™ (Takara). All procedures were following the manufacturer's instructions. GAPDH was used as an internal control for mRNA quantification. The relative expression levels of HE4 mRNA were calculated by the 2−ΔΔCT method. The following sets of primers were used in this study: HE4 forward: 5′-CCGACAACCTCAAGTGCTG-3′; HE4 reverse: 5′-CGAGCTGGGGAAAGTTAATG-3′; GAPDH forward: 5′-TGAGAGGGAAATC GTGCGTGAC-3′; GAPDH reverse: 5′-AAGAAGGAAGGCTGGAAAAGAG-3′.
4
Quantitative Real-Time PCR Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples used in transcriptome sequencing were also used for qRT-PCR. Reactions were performed on an Applied Biosystems 7500 Real-Time PCR using a SYBR Premix Ex Taq™ kit (TaKaRa, Japan) following the manufacturer’s instructions. The combination CaeUBC and CaeEF1 α was used as an internal control (Fan et al., 2017 (link)). Primers were designed using Primer Premier ver. 5.0 to allow for amplification of 80–200 bp products. Gene names, sequences, and the primers used for qRT-PCR analysis are listed in Table S1 . Thermal cycling conditions were 30 s at 95 °C followed by 40 cycles of 5 s at 95 °C and 34 s at 60 °C. A dissociation curve was obtained by heating the amplicon from 60 °C to 95 °C. Each sample was analyzed at least three times. Standard curves were established for all genes investigated using a series of amplicon dilutions. Relative expression level was calculated using the 2−ΔΔCT method (Schmittgen & Livak, 2008 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!