Accuprime pfx dna polymerase

Manufactured by Thermo Fisher Scientific

Sourced in United States

AccuPrime Pfx DNA polymerase is a high-fidelity DNA polymerase designed for accurate DNA amplification. It possesses 3'-5' exonuclease proofreading activity, ensuring precise DNA replication.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

DNA polymerase (71 citations) Pfx DNA polymerase (34 citations) Accuprime Pfx (26 citations) Pfx polymerase (23 citations) AccuPrime DNA Polymerase (17 citations) Accuprime polymerase (15 citations) AccuPrime (15 citations) AccuPrime Pfx polymerase (14 citations) High-Fidelity AccuPrime Pfx DNA polymerase (2 citations) Accuprime pfx supermix DNA polymerase (2 citations)

107 protocols using accuprime pfx dna polymerase

Mutant Fly RNA Extraction and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

mutant stocks were made with GFP balancers. Homozygous 1^st instar larval mutants (GFP-) were hand-picked under a fluorescence microscope. Animals were homogenized and RNA was extracted using the standard Trizol protocol. 2 μg of RNA was treated with Turbo DNase [Ambion] for 45 min before cDNA synthesis using SuperScript III [Life Technology] with random hexamers. rt-PCRs were done using AccuPrime™ Pfx DNA polymerase [ThermoFisher Scientific] with standard protocol using 28 cycles for mRNA and 34 cycles for intermediates.
Bx[RP] - similar to Ubx[RP] and kuz[RP], except for the following differences: homozygous mutant adult flies were homogenized and RNA was extracted using Trizol. 5 μg of RNA was DNase treated and reverse transcribed using random hexamers. rt-PCRs were done using 35 cycles for mRNA and intermediates.
Cell culture: RNA was collected from transfected cells using Trizol. 5 μg of RNA was treated with Turbo DNase [Ambion] for 45 min before cDNA synthesis using SuperScript III [Life Technology] with random hexamers. rt-PCRs were done using AccuPrime™ Pfx DNA polymerase [ThermoFisher Scientific] with standard protocol using 26 cycles and primers that were specific to minigene construct. All primers with descriptions can be found in Supplementary Table 1.

Joseph B., Kondo S, & Lai E.C. (2018). Short cryptic exons mediate recursive splicing in Drosophila. Nature structural & molecular biology, 25(5), 365-371.

+ Open protocol

+ Expand

Cloning and Mutagenesis of ATXN3 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

ATX3‐WT, C14A and UIM* variants cDNAs were amplified by AccuPrime Pfx DNA polymerase (Invitrogen) using Veriti 96‐well thermal cycler (Applied Biosystems). Plasmids pFLAG‐6A‐ATX3Q_22 (WT), C14A and UIM* from Addgene were used as templates to amplify the cDNAs. The cDNAs were cloned in pCDNA5‐FRT/TO‐nEGFP vector using BamH1 and Xho1 restriction endonucleases (NEW ENGLAND BioLabs) and confirmed by DNA sequencing (Source Biosciences). ATX3 variants were generated by site‐directed mutagenesis using AccuPrime Pfx DNA polymerase (Invitrogen) according to the manufacturer's protocol and confirmed by DNA sequencing (Source Biosciences). List of PCR and mutagenic primers is provided as follows.

ATXN3_BamH1_F (ATATGGATCCATGGAGTCCATCTTCCACGAG)	This study (PCR)
ATXN3_Xho1_R (ATATCTCGAGTTATTTTTTTCCTTCTGTTTTCAAATCATTTCTG)	This study (PCR)
ATXN3_VBMRKRR285AKAR_R (ATCAGGTACAAATCTTACTTCAGAAGAGCTTGCGAAGGCACGAGAAGCCTACTTT)	This study (mutagenesis)
ATXN3_VBMAKAR285AAAA_F (CTTCAGAAGAGCTTGCGGCGGCAGCAGAAGCCTACTTTGAAAAAC)	This study (mutagenesis)
ATXN3_VBMAKAR285AAAA_R (GTTTTTCAAAGTAGGCTTCTGCTGCCGCCGCAAGCTCTTCTGAAG)	This study (mutagenesis)

Singh A.N., Oehler J., Torrecilla I., Kilgas S., Li S., Vaz B., Guérillon C., Fielden J., Hernandez‐Carralero E., Cabrera E., Tullis I.D., Meerang M., Barber P.R., Freire R., Parsons J., Vojnovic B., Kiltie A.E., Mailand N, & Ramadan K. (2019). The p97–Ataxin 3 complex regulates homeostasis of the DNA damage response E3 ubiquitin ligase RNF8. The EMBO Journal, 38(21), e102361.

+ Open protocol

+ Expand

Quantifying Translocated Cell Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Increasing amount of translocation positive cells was identified on DNA level via semi-quantitative PCR (AccuPrime Pfx DNA Polymerase, Thermo Fisher Scientific) of 100 ng genomic DNA with primers as previously described [14 (link)]. Proliferation of polyclonal cultures was determined by staining with Trypan blue (Thermo Fisher Scientific) and total cell count was calculated over a period of 120 days. Cell viability was determined by flow cytometry using Fixable Viability Dye eFluor 506 (eBioscience).

Secker K.A., Bruns L., Keppeler H., Jeong J., Hentrich T., Schulze-Hentrich J.M., Mankel B., Fend F., Schneidawind D, & Schneidawind C. (2020). Only Hematopoietic Stem and Progenitor Cells from Cord Blood Are Susceptible to Malignant Transformation by MLL-AF4 Translocations. Cancers, 12(6), 1487.

+ Open protocol

+ Expand

Site-directed mutagenesis of sfroGFP2

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate sfroGFP2^R30S, sfroGFP2^N39Y, and sfroGFP2^R223F, site-directed mutagenesis PCR was performed using pQE30-[sfroGFP2^WT] as a template, AccuPrime™ Pfx DNA polymerase (Thermo Fisher Scientific, Waltham, MA), and specific primer pairs (Supplementary Table S1). Template plasmids were digested using DpnI (Thermo Fisher Scientific). Correctness of mutants was verified by sequencing (LGC genomics).

Heimsch K.C., Gertzen C.G., Schuh A.K., Nietzel T., Rahlfs S., Przyborski J.M., Gohlke H., Schwarzländer M., Becker K, & Fritz-Wolf K. (2022). Structure and Function of Redox-Sensitive Superfolder Green Fluorescent Protein Variant. Antioxidants & Redox Signaling, 37(1-3), 1-18.

+ Open protocol

+ Expand

High-Throughput Gut Microbiome Profiling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from −80°C-stored stool samples using the DNeasy PowerSoil HTP 96 kit (Qiagen) and an EpMotion 5075 automated pipetting system (Eppendorf). The V4 region was amplified for 16S rRNA with the AccuPrime Pfx DNA polymerase (Thermo Fisher Scientific) using custom barcoded primers, as previously described (68 (link)). The ZymoBIOMICS microbial community DNA standards were used as a mock community control (69 (link)), and water was used as a negative control per 96-well extraction plate. The PCR amplicons were cleaned up and normalized with the SequalPrep normalization plate kit (Thermo Fisher Scientific). Amplicons were pooled and quantified with the Kapa library quantification kit (Kapa Biosystems), prior to sequencing using the MiSeq system (Illumina).

Tomkovich S., Stough J.M., Bishop L, & Schloss P.D. (2020). The Initial Gut Microbiota and Response to Antibiotic Perturbation Influence Clostridioides difficile Clearance in Mice. mSphere, 5(5), e00869-20.

+ Open protocol

+ Expand

PFKFB3 and Karyopherin cDNA Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length complementary DNA (cDNA) of PFKFB3 was cloned into the pRK7-N-FLAG or pQCXIH vector using standard protocols. KPNA1, KPNA2, KPNA3, KPNA4, KPNA5 and KPNA6 cDNAs were kind gifts from Dr. Jiahuai Han’s Lab (Xiamen University, Xiamen, China) and sub-cloned into pcDNA3-HA for expression. Point mutations of the indicated constructions were generated by standard site-directed mutagenesis kit (AccuPrime™ Pfx DNA Polymerase, ThermoFisher). All constructions were confirmed by DNA sequencing before further applications.

Li F.L., Liu J.P., Bao R.X., Yan G., Feng X., Xu Y.P., Sun Y.P., Yan W., Ling Z.Q., Xiong Y., Guan K.L, & Yuan H.X. (2018). Acetylation accumulates PFKFB3 in cytoplasm to promote glycolysis and protects cells from cisplatin-induced apoptosis. Nature Communications, 9, 508.

+ Open protocol

+ Expand

RNA Modification and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

1 ug total RNA was incubated with 600 mM sodium acetate (pH 5.2) and 1 M pyridine borane for 16 h at 37 °C in water. The product was purified on Zymo-Spin columns. 100 ng reacted RNA was incubated with 10 μM RT primer and 1 μL 10 mM dNTP mix at 65 °C for 5 min. The reaction was reverse transcribed with Superscript II following the manufacturer’s instructions. cDNA was then PCR amplified by AccuPrime™ Pfx DNA Polymerase (Thermo). The PCR products were gel purified and submitted for high-throughput amplicon sequencing (Genewiz).

Arguello A.E., Li A., Sun X., Eggert T.W., Mairhofer E, & Kleiner R.E. (2022). Reactivity-dependent profiling of RNA 5-methylcytidine dioxygenases. Nature Communications, 13, 4176.

+ Open protocol

+ Expand

Amplification and Cloning of MPK2 from A. thaliana

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MPK2 coding sequence was amplified from a preparation of A. thaliana cDNA using primers containing the attB1 and attB2 sites (Table 2) and the Accuprime Pfx DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR program was the following: 95 °C for 2 min; 35× (95 °C for 15 s, 55 °C for 30 s, 68 °C for 90 s); 72 °C for 10 min. The PCR product was purified by gel band purification and used for BP Gateway recombination with pDONR/ZEO.

Cayuela A., Villasante-Fernández A., Corbalán-Acedo A., Baena-González E., Ferrando A, & Belda-Palazón B. (2024). An Escherichia coli-Based Phosphorylation System for Efficient Screening of Kinase Substrates. International Journal of Molecular Sciences, 25(7), 3813.

+ Open protocol

+ Expand

Genotyping Protocol for Transgenic Fish

Check if the same lab product or an alternative is used in the 5 most similar protocols

Adult fish were anesthetized in MS-222 solution and fin clipping was performed. To extract genomic DNA, the fin tissue was lysed in 50 µL of NaOH (50 mM) and incubated at 95 °C for 1 h in a thermocycler. The reaction was then neutralized with 5 µL of Tris-HCl (1 M) and vortexed briefly. 1 µL of genomic DNA or 100 ng of plasmid control were subjected to PCR amplification using Accuprime™ Pfx DNA polymerase (Thermo Fisher Scientific). The PCR cycle parameters were as follows: initial denaturation at 95 °C for 3 min, and 34 cycles of (i) denaturation at 95 °C for 30 s, (ii) annealing at 59 °C for 30 s, (iii) elongation at 72 °C for 1 min 30 s, followed by a final elongation step at 72 °C for 5 min. The primers used for genotyping are shown in Table 1.Table 1

Primer sequences used for genotyping analysis.

Primer ID	Primer sequence (5′ ––>3′)
IRF4 CDS forward CACC	5′-CACCATGAACCTGGAGGGC-3′
IRF4 CDS reverse	5′-TCATTCTTGAATAGAGGAATGGCGG-3′
mCherry AgeI forward	5′-AATACCGGTATGGTGAGCAAGGG-3′
mCherry ClaI reverse	5′-CCATCGATCTACTTGTACAGCTCGT-3′
rag2 forward	5′-CTGCCGGATCTCCCATGGAC-3′
rag2 reverse	5′-TCATTCTTGAATAGAGGAATGGCGG-3′

Amanda S., Tan T.K., Ong J.Z., Theardy M.S., Wong R.W., Huang X.Z., Ali M.Z., Li Y., Gong Z., Inagaki H., Foo E.Y., Pang B., Tan S.Y., Iida S, & Sanda T. (2022). IRF4 drives clonal evolution and lineage choice in a zebrafish model of T-cell lymphoma. Nature Communications, 13, 2420.

+ Open protocol

+ Expand

RT-PCR Quantification of Minigene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After transfection or RNAi treatment, cells were washed in ice cold PBS and pelleted using centrifugation. RNA was collected using the TRIzol reagent (Invitrogen) under the recommended conditions. 5 μg of RNA was treated with Turbo DNase (Ambion) for 45 min before cDNA synthesis using SuperScript III (Life Technology) with random hexamers. RT-PCR was performed using AccuPrime Pfx DNA polymerase (ThermoFisher Scientific) with standard protocol using 26 cycles and primers that were specific to each minigene construct. All primers are listed and described in S3 Table.

Joseph B, & Lai E.C. (2021). The Exon Junction Complex and intron removal prevent re-splicing of mRNA. PLoS Genetics, 17(5), e1009563.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!