Elongation rate experiments were performed generally as described (Singh & Padgett, 2009 ; Saponaro et al, 2014 ) were grown for 72 h with 4‐HT in 6‐well plates before the addition of 2 μM Flavopiridol (Sigma, F3055) for 4 h to inhibit transcription and allow full run‐off of elongating Pol II molecules. After two consecutive PBS washes, transcription inhibition was released by the addition of fresh complete medium. Every 5 min, one well was washed with PBS and directly lysed in TRIzol reagent (Thermo Fisher, 15596026) at −80°C. Total RNA was isolated following the instructions for the TRIzol reagent. 500 ng of total RNA was used for cDNA synthesis with the Superscript II RT enzyme (Thermo Fisher, 18064014) and random hexamer primers (Roche, 11034731001) following the manufacturer's instructions. RT–qPCRs were performed in triplicates in 20 μl total volume in a Bio‐Rad CFX Connect real‐time PCR detection system with GoTaq qPCR master‐mix (Promega, A6001). We used the Ct threshold cycle determined by the CFX Manager software in accordance with the 2 − Δ Δ C t
Superscript 2 rt enzyme
Manufactured by Thermo Fisher Scientific
Sourced in United States
Superscript II RT enzyme is a reverse transcriptase enzyme used for the conversion of RNA to cDNA. It is a modified version of the Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase that has reduced RNase H activity, allowing for improved cDNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Oligo dt, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Random hexamer primer, by Roche (2 mentions)
Cfx connect real time pcr detection system, by Promega (2 mentions)
Gotaq qpcr master mix, by Promega (2 mentions)
Steponeplus real time pcr, by Thermo Fisher Scientific (2 mentions)
Flavopiridol, by Merck Group (1 mentions)
Rnase free dnase 1, by Qiagen (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Nextera xt index kit, by Illumina (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Rnalater, by Thermo Fisher Scientific (1 mentions)
Hiseq 3000, by Illumina (1 mentions)
Ribo zero kit, by Illumina (1 mentions)
Ambion rna extraction kit, by Thermo Fisher Scientific (1 mentions)
Poly dt primer, by Thermo Fisher Scientific (1 mentions)
11 protocols using superscript 2 rt enzyme
1
Transcription Elongation Rate Measurement
2
Quantitative RNA Analysis in MEFs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 72 h of 4‐HT treatment, WT and Spt5dep MEFs were harvested and counted. Drosophila S2 cells were spiked in at a ratio of 4:1 (4 × 105 MEFs and 1 × 105Drosophila S2 cells). The cells were mixed and stored in TRIzol reagent (Thermo Fisher, 15596026) at −80°C. After obtaining total RNA according to the manufacturer's protocol, we treated the sample with RNase‐free DNaseI (Qiagen, 79254) in 100 ml reaction volume off the column according to the manufacturer's protocol. Following DNA removal, total RNA was again isolated with TRIzol. Next, cDNA synthesis was performed with the Superscript II RT enzyme (Thermo Fisher, 18064014) on 500 ng of DNase‐free total RNA with random hexamer primers (Roche, 11034731001) following manufacturer's instructions. RT–qPCRs were performed in triplicates in 20 μl total volume in a Bio‐Rad CFX Connect real‐time PCR detection system with GoTaq qPCR master‐mix (Promega, A6001). As a negative control to check for genomic DNA contamination, we ran samples not treated with Superscript II RT. We used the Ct threshold cycle determined by the CFX Manager software in accordance with the 2 − Δ Δ C t
3
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from fresh tissues and cell lines was isolated with the RNeasy mini kit (Qiagen, USA) or the mirVana miRNA isolation kit (Ambion, USA), according to the manufacturer's protocols. Following DNase I treatment in order to eliminate genomic DNA contamination, 1 μg of total RNA per sample was used to generate cDNA using Oligo-dT (Invitrogen, USA) and reverse transcriptase (Superscript II RT enzyme, Invitrogen, USA). The resulting cDNAs were subjected to qPCR using specific primers and SYBR Green PCR master mix (Applied Biosystems, USA) in the StepOnePlus Real Time PCR (Applied Biosystems, USA). Gene expression was determined using the delta-delta CT method and the housekeeping gene PPIA (cyclophilin A) was used as reference gene for data normalization. All reactions were performed in triplicate. Pairs of primers are described in S1 Table .
4
Profiling Gamma-Delta T Cell Repertoire
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequencing of the γδ TCR repertoire was performed as previously described [28 (link)]. Briefly, RNA isolated from PBMC was reverse transcribed into complementary DNA using primers specific for the γ-chain (5′-CAAGAAGACAAAGGTATGTTCCAG-3′) and δ-chain (5′-GTAGAATTCCTTCACCAGACAAG-3′) with the SuperScript II RT enzyme (Invitrogen). Purified cDNA (AMPure XP beads, Beckman Coulter) was amplified and an index PCR with Illumina sequencing adapters was generated (Nextera XT Index Kit, Illumina, San Diego, CA, USA). High throughput sequencing (HTS) was completed on the Illumina MiSeq platform (V2 300 kit). Raw fastq file reads were aligned to GenBank derived V, D and J genes and used to build CDR3 sequences using MiXCR software (v.2.1.12) that were subsequently analyzed using VDJtools software (v.1.2.1).
5
Quantitative Analysis of Cytoskeletal Regulators in OSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from 24 fresh tissues samples, 12 from OSCC and 12 from normal oral mucosa, was isolated with TRIzol reagent according to the manufacturer's protocol (Invitrogen). Following DNase I treatment, in order to eliminate genomic DNA contamination, 2 µg of total RNA per sample were used to generate cDNA using Oligo-dT (Invitrogen) and a superscript enzyme (Superscript II RT enzyme, Invitrogen). The resulting cDNAs were subjected to qRT-PCR using SYBR Green PCR Master Mix (Applied Biosystems) in the StepOnePlus Real Time PCR System (Applied Biosystems). Gene expressions were determined by the standard curve method with normalization to the housekeeping gene GAPDH. Primer sequences were to GAPDH 5′ GAAGGTGAAGGTCGGAGTC 3′ (forward) and 5′ GAAGATGGTGATGGGATTTC 3′ (reverse), to Talin-1 5′ CTGTATGTGCAGGCACGAGATGAC-3′ (forward) and 5′-AGCGGACCTTGGCCTCAATCTCA-3′ (reverse), to filamin A 5′-GATCACGGATCCCGAAGGCAAG-3′ (forward) and 5′- AATCTGAATGGTGGGGCCGATG-3′ (reverse), to catenin alpha-1 5′-GCCCAGCTAGCCGCAGAAATGA-3′ (forward) and 5′-TGCAGCCAAAACATGGGCCTTC-3′ (reverse), to filamin B 5′-AGCAGACGCCAAAGCAGAGG -3′ (forward) and 5′- TCAGGAGTGATGACCTGTGGGAC-3′ (reverse).
6
Quantitative RT-PCR for gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from fresh tissues and cell lines was isolated with the RNeasy mini kit (Qiagen, USA) according to the manufacturer's protocols. Following DNase I treatment in order to eliminate genomic DNA contamination, 1 μg of total RNA per sample was used to generate cDNA using Oligo-dT (Invitrogen, USA) and reverse transcriptase (Superscript II RT enzyme, Invitrogen, USA). The resulting cDNAs were subjected to qPCR using specific primers and SYBR® Green PCR master mix (Applied Biosystems, USA) in the StepOnePlus Real Time PCR (Applied Biosystems, USA). Gene expression was determined using the 2-ΔΔCt method and the housekeeping gene PPIA (cyclophilin A) was used as reference gene for data normalization. All reactions were performed in triplicate. The primers used in this study are as follows: FSCN1 (fascin) forward 5’GGCGAGTCTGGCACCTCTT3’ and reverse 5’CCCCAACCGTCCCTTAGC3’, PLEC (plectin) forward 5’GGAGGATGCGTTTCCACAA3’ and reverse 5’ATATCTGAGATCTGGAAGTGCAGAA3’, and PPIA forward 5’GCTTTGGGTCCAGGAATGG3’ and reverse 5’GTTGTCCACAGTCAGCAATGGT3’.
7
Skin RNA-seq protocol for murine and human samples
8
PS1Δ8 Deletion Analysis in Embryo Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryo brains were removed from the skull, and the left hemisphere was snap-frozen for Western blot analysis while the right hemisphere was snap-frozen for RNA extraction. Total RNA was extracted using the Ambion RNA extraction kit (Life Technologies, Carlsbad, CA). One μg of RNA was reverse-transcribed using the Superscript II RT enzyme (Invitrogen, Life Technologies) and a poly(dT) primer (Invitrogen, Carlsbad, CA) followed by PCR amplification using the primers (forward 5′-CCCATTCACAGAAGATACCGAGAC-3′; reverse
5′-GAGTCACAAGACACTGTTGCAGAG-3′) flanking the PS1∆8 deletion.
5′-GAGTCACAAGACACTGTTGCAGAG-3′) flanking the PS1∆8 deletion.
9
Genetic Variant Confirmation and Functional Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Variant segregation of the identified candidate variants was performed when possible. For this purpose, families were re-contacted. Variants were confirmed by conventional Sanger sequencing, as previously described.
Putative splicing mutations were also tested using blood RNA. Briefly, RNA was extracted from peripheral blood and cDNA was obtained using Superscript RT II enzyme (Invitrogen, Carlsbad, CA, USA) from 1 µg of total RNA extracted in a volume of 20 µL. cDNA was then amplified and sequenced to identify potential splicing variants.
Additional biochemical studies were also performed when required. In this way, plasma creatine, creatinine, and guanidoacetate levels were measured by Liquid chromatography—tandem mass spectrometry (LC-MS/MS) following the protocol described by Bodamer et al. (2001) [29 (link)] to determine creatine deficiency syndrome.
Putative splicing mutations were also tested using blood RNA. Briefly, RNA was extracted from peripheral blood and cDNA was obtained using Superscript RT II enzyme (Invitrogen, Carlsbad, CA, USA) from 1 µg of total RNA extracted in a volume of 20 µL. cDNA was then amplified and sequenced to identify potential splicing variants.
Additional biochemical studies were also performed when required. In this way, plasma creatine, creatinine, and guanidoacetate levels were measured by Liquid chromatography—tandem mass spectrometry (LC-MS/MS) following the protocol described by Bodamer et al. (2001) [29 (link)] to determine creatine deficiency syndrome.
10
Quantifying miRNA in Cerebrovascular Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total miRNA was isolated from purified primary cerebrovascular endothelial cells (pCECs) using the miRNeasy mini kit protocol (Qiagen, Valencia, CA), and then converted to cDNA using oligo dT, random hexamers with Superscript RT II enzyme (Invitrogen, Grand Island, NY). Real-time PCR was performed using SYBR Green master mix (Qiagen, Valencia, CA) and predesigned primers (synthesized by Qiagen), normalized to internal control miR-39 expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!