Anti mcherry

Antibodies were incubated with Dynabeads protein G (Invitrogen, Carlsbad, US) at 4°C for at least 30 minutes. Cells were lysed in NP-40 buffer (Beyotime, Shanghai, China) supplemented with protease inhibitor cocktail (Thermo Fisher, Waltham, US). Cell lysate was incubated with antibody-coated beads at 4 °C overnight. Antibodies used for immunoblotting and co-immunoprecipitation included anti-Vam6 (Thermo Fisher, Waltham, US), anti-VDAC1 (Abcam, Cambridge, UK), anti-Rab7a (NewEast, Kelayres, US), anti-AMPKγ (Invitrogen, Carlsbad, US), anti-mCherry (Invitrogen, Carlsbad, US), anti-β-actin (Proteintech, Chicago, US), and rabbit IgG isotype ctrl (Invitrogen, Carlsbad, US). HRP-conjugated secondary antibodies included mouse-anti-rabbit IgG light chain (CST, Danvers, US), goat-anti-mouse IgG (H+L) (Proteintech, Chicago, US), and goat-anti-rabbit IgG (H+L) (Proteintech, Chicago, US). Antibodies and isotype controls used in co-immunoprecipitation experiments were at 1 μg/mL, and antibodies for immunoblotting were used at 1:1000 dilution unless other described.

E. faecalis OG1RFΔsrtA was transformed with plasmid pGCP123::PsrtA srtA‐2 L‐mCherry in which SrtA‐mCherry fusion is expressed on a plasmid and transcribed from the native srtA promoter. The wild‐type srtA native promoter was amplified using primers KpnI‐PsrtA‐F (5′‐ATCCGGTACCGCTTGTTTCTTTTACTTTAAAATTCCA‐3′) and XhoI‐PsrtA‐R (5′‐AAGCCTCGAGATTCTCCCTCCTTTTAATGT‐3′) and the srtA gene was amplified using primers XhoI‐SrtA‐F (5′‐GAATCTCGAGATGCGCCCAAAAGAGAAAAA‐3′) and EcoRI‐SrtA‐R (5′‐ATCCGAATTCAGCCACCCAATCGGCTAA3′), using E. faecalis OG1RF as template. mCherry was amplified using primers EcoRI‐SrtA‐R (5′‐ATCCGAATTCATGGTGAGCAAGGGC‐3′) and NotI‐STOP‐XbaI‐BamHI‐mCherry‐R (5′‐AATCGCGGCCGCCTATCTAGAGGATCCCTTGTACAGCTCGTCCAT‐3′). These three PCR products were ligated together using primer embedded restriction sites XhoI and EcoRI respectively. The resulting fusion product was cloned into PGCP123 (Nielsen et al., 2012 (link)) using primer embedded restriction sites KpnI and NotI. The expression and stability of the fusion was verified with anti‐mCherry (Invitrogen, USA) and anti‐SrtA (SABio, Singapore) immunoblotting of whole‐cell E. faecalis lysates.

Hair cells were labeled with HCS-1, which is specific for otoferlin (Goodyear et al., 2010 (link)). HCS-1 was developed by Jeffrey Corwin (University of Virginia) and obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH, and maintained at the Department of Biology of the University of Iowa. HCS-1 was obtained as a purified concentrate and used at 1:500 dilution. The YFP or mCherry signals in macrophages were amplified by labeling with either anti-GFP or anti-mCherry (1:500; Thermo Fisher Scientific).

Mice were anesthetized with 200 mg/kg pentobarbital and perfused transcardially with 4% paraformaldehyde (PFA) in PBS. Brains were isolated and fixed overnight in 4% PFA before storage in 1 X PBS. Brains were sectioned with a vibratome between 60–100 µm or a cryostat at 30 µm and mounted on slides (Fisher Permafrost). Vibratome sections were permeabilized with 1 X PBS with 0.2% Triton-X100, mounted on slides, and coverslipped with mounting media containing DAPI. All injection sites were aligned back to the Allen Brain Atlas, injection sites with substantial off-target infection were excluded. In the cannula experiments, signal from the AAV2/9-CAG-DIO-DREADD(h4Dmi) was amplified using anti-mCherry (Abcam: ab167453) at 1:500 by first blocking with 1 X PBS with 10% goat serum and 0.3% Triton X-100 for one hour at room temperature, incubated with anti-mCherry overnight at 4 °C, followed by incubation with goat anti-rabbit 568 (Thermo Scientific: A-110011) for one hour at room temperature, and cover slipped with DAPI mounting media. For identification of excitatory cortical neurons in layer II/III, anti-Foxp1 (Abcam: ab16645 1:500) was used with goat anti-rabbit 488 (Thermo Scientific: A-11008). Slides were visualized and imaged with a Nikon Ti-1200.

Hair cells were labeled with HCS-1, which is specific for otoferlin. HCS-1 is an IgG2a mouse monoclonal and was obtained from the Developmental Studies Hybridoma Bank (University of Iowa) as a purified concentrate and used at 1:500 dilution. The YFP or mCherry signals in macrophages were amplified by labeling with either anti-GFP or anti-mCherry (1:500, ThermoFisher, Waltham, MA, USA).