Vectors expressing human IRF3-5D, human TBK1 and pTATA-luc-4x-IRF-3 are generous gifts from Dr. Aldofo Garcia-Sastre ( Mount Sinai School of Medicine), Dr Harry Greenberg (Stanford University) and Dr Stephan Ludwig (University of Munster) respectively All primers used in the study for respective constructs are given in Table 1 . Full length NSP1, NSP2, NSP3, NSP4, NSP5 and ubiquitin were cloned in pcDNA6 vector (Invitrogen) with C-terminal His-Tag as described previously [29] (link). To prepare pcDNA vectors containing the NSP1 ORFs of RV strains OSU (accession number D38153), DS-1 (accession number EF672578), Wa (accession number L18943), KU (accession number AB022769) and different truncated mutants of NSP1, viral RNA was extracted from infected cells by using TRIzol LS reagent (Invitrogen). Gene 5 cDNAs were prepared from the RNA by reverse transcription (RT)-PCR followed by PCR with respective primer sets. Full length MAVS (accession number BC044952), region specific mutants of MAVS were cloned in pFLAG-CMV (Sigma, MO) vector using specific primers.
Pcdna6 vector
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom, United States
The PcDNA6 vector is a mammalian expression vector used for the transient or stable expression of recombinant proteins in a variety of cell lines. It contains a cytomegalovirus (CMV) promoter for high-level expression and a blasticidin resistance gene for selection of transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
Trizol ls reagent, by Thermo Fisher Scientific (1 mentions)
Nickel chelate column, by Qiagen (1 mentions)
Fugene 6, by Promega (1 mentions)
Lipofectamin, by Thermo Fisher Scientific (1 mentions)
Plus reagent, by Thermo Fisher Scientific (1 mentions)
Pegfp c1 vector, by Takara Bio (1 mentions)
Pcdna3.1 v5 his vector, by Thermo Fisher Scientific (1 mentions)
Polyethylenimine (pei), by Polysciences (1 mentions)
Polyethylenimine (pei), by Thermo Fisher Scientific (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Polyethylenimine max, by Polysciences (1 mentions)
Quikchange 2 xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Pei max, by Polysciences (1 mentions)
Seeblue plus2 pre stained protein standard, by Thermo Fisher Scientific (1 mentions)
Ponceau s solution, by Merck Group (1 mentions)
Dmem high glucose medium, by Merck Group (1 mentions)
Rin m5f cells, by American Type Culture Collection (1 mentions)
Pcdna3 vector, by Thermo Fisher Scientific (1 mentions)
Lipofectamine plus reagent, by Thermo Fisher Scientific (1 mentions)
10 protocols using pcdna6 vector
1
Cloning and Expression of SARS-CoV-2 NSP Proteins
2
Engineered Fusion Protein for Targeted Immunotherapy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 1-11E/vIL-10 fusion was cloned into pcDNA6 vector (Invitrogen, Paisley, UK). vIL-10 was PCR with the following primers: Forward: 5′-AAAGCGGCCG CAGGGGGAGGCGGATCCCCGCTCGGGCTTTGGGCGGGAGGGGGCTCACAATGT GACAATTTTCCC-3′ and reverse: 5′TTTTGCGGCCGCCCTGGCTTTAATTGTCAT-3′. This resulted in vIL-10 omitted from its signal peptide at the 5′ end and replaced with the MMP cleavage site (PLGLWA) flanked by Gly4Ser1 linker from both sides (Figure 1 A). After cloning IL-10 into the NotI and SacII restriction sites, the scFv was amplified to contain the TNFR2 signal peptide (MAPAALWVALVFELQLWATGHT): forward: 5′-ATATATAAGCTT ATGGCGCCCGCCGCCCTCTGGGTCGCGCTGGTCTTCGAACTGCAGCTGTGGGCCACCGGGCACACATCTAGAATGGCCGAGGTGCAGCTG-3′, and reverse: 5′-ATATATGC GGCCGCCCGTTTGATTTCCACCTT-3′ and cloned into the HindIII and NotI. Similarly, hen egg lysozyme-specific scFv, C7, was cloned as fusion to vIL-10 (C7/vIL10) as nonrelevant scFv for negative control.
We performed transient transfections by using adherent HEK-293 cells using FuGENE 6 and according to manufacturer’s instructions (Promega UK, Southampton, UK). Culture medium was harvested after 3 days, and fusion protein was purified by using a nickel chelate column (QIAGEN, Crawley, UK) and following the manufacturer’s instructions.
We performed transient transfections by using adherent HEK-293 cells using FuGENE 6 and according to manufacturer’s instructions (Promega UK, Southampton, UK). Culture medium was harvested after 3 days, and fusion protein was purified by using a nickel chelate column (QIAGEN, Crawley, UK) and following the manufacturer’s instructions.
3
Cloning and Transfection of Rat LIMLE mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length rat LIMLE mRNA sequence was cloned from rat testis cDNA by PCR with the specific primers: rLIMLE (Up-ACGCGGATCCATGGCGCGGAATGTGTATGGTCC , Lo-ATAGTTTAGCGGCCGCCCTGTATTGATGCCCATGGCCTGCTC ) (Eurofins MWG) and inserted into the pcDNA6 vector (Invitrogen). 6×104 COS (CV-1 (simian) in origin, and carrying the SV40) fibroblast-like cell line derived from monkey kidney tissue (kindly provided by the Etablissement Français du Sang (EFS, Nantes, France) which acquired it from L ife Technologies)), or rat BMDC (day 8 of culture) were plated on Microscope Cover glasses (Marienfield GmbH & Co.KG) in 12-well plates (Nunc; Merck/Eurolab France) for 24 hours. Cells were transfected with pcDNA6 plasmid with lipofectamin (Invitrogen) and Plus reagent (Invitrogen) for COS and with Nucleofector Kit Dendritic cell (Lonza) for BMDCs, according to the manufacturer's instructions. Cells were stained 24 hours after transfection.
4
Expression Constructs for Meiotic Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Meiob and Spata22 expression constructs were previously described (19 (link)). Mouse and human Meiob cDNAs were subcloned into the pcDNA6 vector (Invitrogen) harboring an N-terminal Flag tag and a C-terminal Myc tag. Mouse and human Spata22 cDNAs were subcloned into the pcDNA6 vector harboring an N-terminal Flag tag. All Meiob mutations were generated by PCR and subcloned into the pcDNA6 vector. Green fluorescent protein (GFP)-Meiob, N64I, ΔS67, Mlh1, Msh4 and Rnf212 constructs were generated by subcloning into the pEGFP-C1 vector (Clontech). Tex11-V5 construct was generated by subcloning into the pcDNA™3.1/V5-His vector (Invitrogen). All the constructs were verified by Sanger sequencing on an ABI 3730 DNA analyzer.
5
β-Arrestin Recruitment and cAMP Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For β-arrestin recruitment assays, HEK-293T cells were harvested using Trypsin/EDTA and 3 × 106 cells were seeded in 10 cm diameter-tissue culture dishes twenty-four hours prior to transfection. DNA mixtures comprising 8 μg β-arrestin 1-EYFP, β-arrestin 2-EYFP or empty pcDNA3 plasmid and 2.4 μg HA-CXCR1-RLuc or HA-CXCR2-RLuc were prepared in a total volume of 1.5 ml Opti-MEM (Gibco, Life Technologies, Carlsbad, CA, USA) and 32 μg of the transfection reagent polyethylenimine (PEI; Polyscience, Eppelheim, Germany) were added, mixed and incubated at room temperature (RT) for 20 min. For cAMP experiments, HEK-293T cells were transfected according to the same protocol, using 32 μg PEI to transfect 10,5 μg plasmids obtained after cloning cDNA encoding human CXCR1 or CXCR2 into pcDNA6 vector (Invitrogen). DNA/PEI mixtures were dropwise distributed on cells kept in DMEM without antibiotics supplemented with 10% (v/v) FBS and incubated for 48 h. The expression of β-arrestins and chemokine receptors was verified by flow cytometry.
6
Studying Voltage-Gated Calcium Channels in HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum, 1% penicillin, and streptomycin in a 5% CO2 incubator. Similar to our recent report18 (link), recombinant cDNA constructs of human TPC1 (GenBank: AY083666.1) and human TPC2 (GenBank: BC063008.1) with FLAG and V5 epitopes on their C-termini were constructed with pCDNA6 vector (Invitrogen). To facilitate identification of transfected cells, an IRES-containing bicistronic vector, pCDNA6-TPC2-V5-IRES-AcGFP18 (link), was used in the electrophysiological experiments. Mutations were made with QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). Cells were transiently transfected with plasmids with transfection reagent of Lipofectamine 2000 (Invitrogen) or polyethylenimine “Max” (PEI Max from Polysciences) and subjected to experiments within 16–48 h after transfection. For the cell health of the mutant L690A/L694A after transfection, 2.0 µM YM201636 was added into the complete serum medium to block TPC2. For human TPC1 channels, pEGFP-C1 was cotransfected at the same time to identify transfected cells for patch clamp recording. Cells were treated with 1% trypsin 4–6 h after transfection and seeded on polylysine-treated glass coverslips soaked in an incubator until recording.
7
Assessing Upstream ATG Role in IRF10 Translation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To test if the upstream ATG or open reading frame (ORF) in fish IRF10 has a role in regulation of translation, the 5’-UTR and ORF of trout IRF10a was cloned downstream of the T7 promoter of the pcDNA6 vector (Invitrogen). Three constructs were made; the first contained the uATG, the second had the uATG mutated to ATC, and the third had the 5’-UTR completely removed (Fig 1A ). After sequence confirmation, 1 μg of each plasmid was translated using a TNT T7 Coupled Transcription/Translation and Tanscend™ tRNA detection system (Promega) as per the manufacturer’s instructions. The translated proteins were labelled via biotinylated tRNA and detected by Western-blotting using Streptavidin-Alkaline Phosphatase and chemiluminescent detection, as described previously [23 (link)]. The efficiency of protein transfer was assessed by staining the membrane with Ponceau S solution (Sigma-Aldrich, UK). The protein size was determined by SeeBlue® Plus2 Pre-stained Protein Standard (Life Technologies, UK).
8
Heterologous Expression of L-type Calcium Channels
9
siRNA Knockdown and Overexpression of ABHD10 and PRDX5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNAs were as follows: Silencer Select Negative Control No. 1 siRNA (#4390843, Thermo), Silencer Select siRNA against ABHD10 (#4392420, Thermo), and Silencer Select siRNA against ELK3 (#4390771, Thermo). For PHH cells and Hep3B cells, siRNAs were used at respective working concentrations of 20 pM and 10 pM. Lipofectamine-RNAiMAX (Invitrogen) was used to transfect siRNAs into cells. Experiments were conducted at 48 h post-transfection.
For ABHD10 overexpression, the human ABHD10 clone (NM_018394, SC319244, Origene) was cloned into a pcDNA6 vector (Invitrogen) under the control of a CMV promoter. For ABHD10 knockdown with or without rescue overexpression of WT PRDX5 or non-palmitoyable, catalytically-inactive PRDX5 mutant PRDX5C100S, a modified pcDNA6 vector containing an ABHD10 shRNA (under control of a U6 promoter) combined with an overexpression cassette containing a scrambled control cDNA, PRDX5 cDNA, or the PRDX5C100S cDNA (under control of a CMV promoter and an internal ribosomal entry site) was constructed51 . Lipofectamine 3000 (Invitrogen) was used to transfect plasmids. Experiments were conducted at 48 h post-transfection.
For ABHD10 overexpression, the human ABHD10 clone (NM_018394, SC319244, Origene) was cloned into a pcDNA6 vector (Invitrogen) under the control of a CMV promoter. For ABHD10 knockdown with or without rescue overexpression of WT PRDX5 or non-palmitoyable, catalytically-inactive PRDX5 mutant PRDX5C100S, a modified pcDNA6 vector containing an ABHD10 shRNA (under control of a U6 promoter) combined with an overexpression cassette containing a scrambled control cDNA, PRDX5 cDNA, or the PRDX5C100S cDNA (under control of a CMV promoter and an internal ribosomal entry site) was constructed51 . Lipofectamine 3000 (Invitrogen) was used to transfect plasmids. Experiments were conducted at 48 h post-transfection.
10
Plasmid Construction for SNP rs2074196 Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reporter plasmids that contain the luciferase gene under the control of the SNP rs2074196 region were constructed as follows: complementary oligonucleotides containing 3 copies of the SNP region were synthesized. These oligonucleotides were annealed and cloned into the pGL4.10 vector (Promega Corp.) along with the thymidine kinase promoter derived from pGL4.74 (Promega Corp.).
To construct mammalian expression plasmids, cDNA of NF-YA, NF-YB, NF-YC and CUX1 were amplified by PCR and subcloned into the pcDNA6 vector (Invitrogen Life Technologies, Carlsbad, CA, USA) to allow the expression of these cDNAs under the control of a CMV promoter. During PCR amplification, FLAG-tag was fused at the C-terminus of NF-YA; HA-tag was fused at the C-terminus of NF-YB; and Myc-tag was fused at the C-terminus of NF-YC. All the Table Ⅰ. Oligonucleotides used for the preparation of the DNA-immobilized nanobeads.
To construct mammalian expression plasmids, cDNA of NF-YA, NF-YB, NF-YC and CUX1 were amplified by PCR and subcloned into the pcDNA6 vector (Invitrogen Life Technologies, Carlsbad, CA, USA) to allow the expression of these cDNAs under the control of a CMV promoter. During PCR amplification, FLAG-tag was fused at the C-terminus of NF-YA; HA-tag was fused at the C-terminus of NF-YB; and Myc-tag was fused at the C-terminus of NF-YC. All the Table Ⅰ. Oligonucleotides used for the preparation of the DNA-immobilized nanobeads.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!