Pyromark assay design software 1

The bisulfite modified DNA sample was then 10-fold diluted and 1 μL of diluted DNA was used in PCR reactions with 3 μL 10xPCR buffer, 200 μL/L of dNTPs, 6 pmol forward primer, 6 pmol reverse primer, and 3 mmol/L MgCl₂, 0.75 U Qiagen HotStar Taq polymerase (Qiagen Inc., Valencia, CA., 205203) in 30 μL total volume adjusted using double distilled H₂0, as necessary. The PCR cycling condition was as follows: 95 °C 15 min; 45 x (95 °C 30 s; 51 °C 30 s: 72 °C 30 s); 72°C 10 min; 4 °C∞. The PSQ96HS system was used according to standard procedures for the Pyrosequencing TM analysis. DNA methylation pattern of COL1A1, MMP2, MMP9, and TIMP1 was analyzed by bisulfite pyrosequencing in an external lab (IMIBA, Malaga, Spain). Quantitative sodium bisulfite pyrosequencing was performed, as previously described (45 (link)), for the genes that showed differences in the transcriptomic analysis between endometrial categories, and comprised: COL1A, MMP2, MMP9 and TIMP1. In brief, targeted assays were designed using the PyroMark Assay Design Software 1.0 (Qiagen). Forward, reverse, and sequencing primers were used for PCR and pyrosequencing (Supplementary Table 2). The % of methylation was calculated as a mean of the CpG sites that passed quality control. Samples were considered for the study where at least 80% of the CpG sites passed quality control.

Quantitative sodium bisulfite pyrosequencing was performed for THOR as previously described [27 (link)]. In brief, targeted assays were designed using the PyroMark Assay Design Software 1.0 (Qiagen). Forward ATGATGTGGAGGTTTTGGGAATAG, reverse CCCAACCTAAAAACAACCCTAAAT and sequencing GGAGGTTTTGGGAATAG primers were used for PCR and pyrosequencing. The assay target region was 36 bp in length comprising 5 CpG sites. In our assay < 5% of the samples failed pyrosequencing analysis. Calculation of the % of THOR methylation was done as a mean value of these sites as previously described [27 (link)]. For clinical correlative studies we used the cut-off of 20% methylation with an AUC of 0.799 (p < 0.0001).

Three genes were chosen as biomarkers that demonstrate the greatest degree of segregation between CPCs and CPPs, and the corresponding CpG sites were validated for differential methylation between these tumor groups using both the initial discovery panel of 34 samples and a validation set of 22 samples. Quantitative sodium bisulfite pyrosequencing was performed for AK1 (cg14578146), PER2 (cg11903188), and PLSCR4 (cg07038342). All targeted assays were designed using the PyroMark Assay Design Software 1.0 (Qiagen). All primer sets are listed in Additional file 1: Table S4. Sodium bisulfite-modified genomic DNA was amplified using Hot-Start Taq Master Mix (Qiagen) as previously described [16 (link)]. Regions of interest were amplified by PCR, and pyrosequencing was carried out using the PyroMark Q24 pyrosequencer (Qiagen) according to the manufacturer’s protocol (Pyro-Gold reagents). Output data were analyzed using PyroMark Q24 1.0.10 Software (Qiagen), which calculates the methylation percentage β for each CpG site, allowing quantitative comparisons.