Superscript 3 frist strand synthesis system

To determine Dcaf17 mRNA levels in different tissues and during testis development, adult WT mouse tissues (brain, liver, pancreas, skin and testis) and 5, 14, 23, 32, 42 and 56 days postpartum (dpp) testes were collected and snap frozen immediately by immersing in liquid nitrogen. Total RNA was extracted using QIAGEN RNeasy mini kit and then treated with DNase I according to the manufacturer’s protocol (Qiagen, Valencia, CA, USA). The RNA quality was checked by visualizing intact 28S and 18S RNA bands on agarose gel-electrophoresis using ethidium bromide staining. Quantification of total RNA was carried out using NanoDrop 2000c spectrophotometer (Thermo Scientific, ThermoFisher Scientific, Waltham, MA, USA). Reverse transcription was performed on 500 ng total RNA from each tissue using Superscript III Frist Strand Synthesis system (Life Technologies, ThermoFisher Scientific, Waltham, MA, USA) as per manufacturer’s protocol.

Total RNA was extracted using Trizol (Life Technologies, Carlsbad, CA, USA). For reverse transcription PCR (RT‐PCR), cDNA was obtained using the SuperScriptIII^® Frist‐Strand Synthesis System (Life Technologies). Gene expression was monitored by PCR assay. The primer sequences were as follows: sST2 forward, 5′‐ GGCACACCGTAAGACTAAGTAG‐3′ and sST2 reverse, 5′‐CAATTTAAGCAGCAGAGAAGCTCC‐3′; β‐actin forward, 5′‐CCCAGCCATGTACGTTGCTAT‐3′ and β‐actin reverse, 5′‐TCACCGGAGTCCATCACGAT ‐3′. Levels of miR‐202‐3p and U6 were monitored by quantitative RT‐PCR using the Bulge‐Loop™ miRNA RT‐PCR primer set (RiboBio Co., Ltd. Guangzhou, China).