Dl1000 dna marker

The family atlas of the white sika family was plotted on the basis of genealogical records from the deer farm. The Primer 5.0 software was used to design specific SCF gene primers. Primer SCF-1 could only amplify mutated gene sequence fragments, while primers SCF-2, SCF-3, and SCF-4 could only amplify normal gene sequence fragments. The amplification reaction system was set to 25 μL: 11.5 μL of Mix (Cwbio, jiangsu, China), 11.5 μL of ddH₂O, 0.5 μL each of the upstream and downstream primers, and 1 μL of DNA template. Reaction conditions were as follows: pre-denaturation at 95 °C for 5 min; denaturation at 30 cycles of 95 °C for 10 s (see Table S2 for annealing temperature); extension at 72 °C for 30 s; holding at 4 °C for 5 min.
After amplification, the standard bands were electrophoresed on a 2% gel, and standard bands were used with DL1000 DNA marker (Takara, Beijing, China). The presence or absence of electrophoretic bands were observed, the family members were genotyped, and the inheritance mechanism of the mutated gene was analyzed in relation to the phenotype and genotype. The samples amplified from SCF-1 were used for Sanger sequencing, and the MEGA 7.0 software was used to compare whether there were differences between sequenced fragments and the normal SCF gene fragment sequence, which was extracted from the reference genome of sika deer.

To determine the RBBP7 (chrX:16863960-/T) SNP in this family and in the 103 unrelated patients with NOA, we carried out the PCR-RFLP method. Primers were used to amplify RBBP7 (forward primer: AAATAGCAAACAGTGGACGAA; reverse primer: TGAGGATAACATCATGCCGAT). The PCR conditions were as follows: denaturation at 94°C for 3 minutes followed by 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds for 35 cycles, with a final extension at 72°C for 5 minutes. The PCR products were treated with Bgl I (Takara, code 1020A) restriction enzyme. The PCR product of the wild-type RBBP7 was cut into a 19 bp and a 207 bp fragment at 37°C, whereas the PCR product of the RBBP7 mutation could not be cut. The resulting fragments were separated by electrophoresis in a 3% agarose gel containing 10 μg/mL ethidium bromide for 40 minutes at 100 V. The sizes of the resulting DNA fragments were estimated by comparison to that of a commercial DL1000 DNA marker (Takara, code 3591A).

The PC-3 and LNCaP cell lines were obtained from the Kunming Institute of Zoology, Chinese Academy of Sciences. Recombinant human IL-6 was purchased from R&D Systems (Minneapolis, MN). Gibco RPMI 1640 medium and fetal calf serum were purchased from Life Technologies (Grand Island, NY); HyClone 0.25% trypsinase from GE Healthcare Life Sciences (Piscataway, NJ); and DMSO from Sigma-Aldrich (St. Louis, MO). Anti–miR-21 inhibitor and anti–miR-21 negative control were purchased from ABI Biotech (USA). Lipofectamine 2000 was purchased from Invitrogen (Carlsbad, CA). The RNAiso Plus kit for RNA isolation, PrimeScript RT reagent kit for cDNA reverse transcription, and Perfect Real Time kit for quantitative real-time PCR (qRT-PCR) were purchased from Takara Bio (Mountain View, CA) along with the DL1000 DNA marker. Primers for PDCD4 and GAPDH were obtained from Sangon (China). Human anti-PDCD4 monoclonal antibody and rabbit polyclonal anti–β-actin antibody were purchased from Abcam (Cambridge, MA). Anti-rabbit IgG, HRP-linked antibody was purchased from Cell Signaling Technology (Danvers, MA). The BCA protein assay kit and the RIPA lysate buffer were purchased from Beyotime Institute of Biotechnology (China). In situ hybridization kits for HSP and DAB were purchased from LBP Biotech Company (China).