Mission shRNA Lentiviral particles, namely clones TRCN0000078543 (MSH6), TRCN0000298603 (MSH6), TRCN0000010384 (MSH2), TRCN0000039670 (MSH2), TRCN0000084059 (MSH3), TRCN0000084062 (MSH3), TRCN0000288641 (MLH1), TRCN0000288642 (MLH1), and Mission shRNA Non-Target Control Transduction Particles were purchased from Sigma Aldrich. KLE cells were transfected with a MOI of 5, according to the manufacturer’s protocol, and pooled clones per lentivirus were selected in puromycin to yield polyclonal populations of cells. CT-26 Msh2KO mouse cells were generated by the Institution’s CRISPR Core Facility (Supplementary Figure S6B ). Briefly, two guide RNA (gRNA) sequences (gRNAl: CGGCGACTTTTACACGGCGC and gRNA2: CGTGATCAAGTACATGGGGC) were used, and the bi-allelic deletions in MSH2 mRNA/genomic DNA were confirmed by sequencing the positive clones. HCT116 MLHl+/− was acquired from Horizon Discovery Limited (catalog ID HD 104–006) and used for re-expression experiments.
Mission shrna non target control transduction particles
Manufactured by Merck Group
Sourced in United States
The Mission shRNA Non-Target Control Transduction Particles is a laboratory product used in gene expression studies. It is designed to serve as a negative control for shRNA-mediated gene knockdown experiments.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using mission shrna non target control transduction particles
1
Genetic Manipulation of Mismatch Repair Genes
2
Stable Knockdown of DNA Repair Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mission shRNA lentiviral particles, namely, clones TRCN0000083196 (XPA), TRCN0000307193 (XPC), TRCN0000507788 (ERCC5), TRCN0000016774 (ERCC6), TRCN0000078583 (ERCC4), and mission shRNA non-target control transduction particles, were purchased from Sigma Aldrich. Day 1: MCF-10A cells were counted and then seeded 5 × 104 cells in a six-well plate with fresh media, and each lentiviral construct and control groups were used in triplicate wells. Day 2: half of the old media were replaced by fresh media and 2–15 μL individual lentiviral virus (Sigma) targeting XPA, XPC, ERCC4, ERCC5, ERCC6 was added to each well with 8 μg/mL Hexadimethrine bromide. Then, the six-well plate was swirled lightly to mix and incubated in a humidified 5% CO2 incubator at 37 °C. Day 3: we removed the media containing lentiviral particles from the six-well plate, and then added fresh media to a volume of 2 mL to each well. Day 4: we added fresh media with 2 μg/mL puromycin. Day 5 and on: fresh puromycin media were replaced every 3~4 days until the formation of resistant colonies. Finally, the stable resistant cell lines were identified.
3
RASSF1C Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RASSF1C was silenced using Mission Non-Target shRNA Control Transduction Particles or with multiple Mission Lentiviral sh-RNA Transduction Particles (NMID: NM_007182, Sigma, St. Louis, MO, USA) as previously described [8 (link)].
4
RASSF1C Silencing in Lung Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung cancer cells (NCI-H1299) were plated at 5000/well in 96–well plates 24 hr. before infection and cells were infected with Mission Non-Target shRNA Control Transduction Particles or with multiple Mission Lentiviral shRNA Transduction Particles (NMID: NM_004764) for silencing RASSF1C (Sigma, St. Louis, MO) as previously described [14] (link). Cells were treated with polybrene (Sigma, ST. Louis, MO) for two hours before adding Lentiviral particle at a Multiplicity of Infection (MOI) of 5. Knockdown validation of piwil1 expression was assessed by Western blot and qRT-PCR using RASSF1C antibody and RASSF1C specific primers, respectively. The experiments were repeated at least 3 times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!