Log In Sign up
The largest database of trusted experimental protocols

Pl crispr sffv gfp

Manufactured by Addgene
Visit Supplier

The PL-CRISPR.SFFV.GFP is a plasmid that contains a CRISPR/Cas9 system with a green fluorescent protein (GFP) reporter. The plasmid is designed for use in gene editing and expression studies.

Automatically generated - may contain errors

Lab products found in correlation

Fugen hd, by Promega (1 mentions) T4 ligation buffer, by New England Biolabs (1 mentions) T4 ligase, by New England Biolabs (1 mentions) T4 pnk, by New England Biolabs (1 mentions) Cd8 percp clone sk1, by BD (1 mentions) Pspax2, by Addgene (1 mentions) Pmd2 g, by Addgene (1 mentions)

Close spelling variants of this product

PL-CRISPR

3 protocols using pl crispr sffv gfp

1

CRISPR-Mediated Knockout of miR-148a in Melanoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CRISPR guides flanking miR-148a were designed using crispr.mit.edu software from the Zhang lab (Cong et al., 2013 (link)). Selected guides, targeting regions upstream (gttctaatctgaggacgggt) and downstream (ccaattcccttgaagcgggt) of miR-148a were cloned separately into pL-CRISPR.SFFV.GFP (a kind gift from Benjamin Ebert; Addgene plasmid # 57827). Both vectors were co-transfected for 48h into MNT-1 melanoma cells using Fugen HD (Promega) according to manufacturer’s specifications, before single cell sorting into 96 well dishes. Once the cultures were established, the clones were screened by sequencing of the miR-148a locus. Generation of CRISPR line was more successful in MNT-1 line compare to other melanoma lines.
Malcov-Brog H., Alpert A., Golan T., Parikh S., Nordlinger A., Netti F., Sheinboim D., Dror I., Thomas L., Cosson C., Gonen P., Stanevsky Y., Brenner R., Perluk T., Frand J., Elgavish S., Nevo Y., Rahat D., Tabach Y., Khaled M., Shen-Orr S.S, & Levy C. (2018). UV-Protection Timer Controls Linkage between Stress and Pigmentation Skin Protection Systems. Molecular Cell, 72(3), 444-456.e7.
+ Open protocol
+ Expand
2

Generation of CRISPR-engineered cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The U6-sgRNA-SFFV-puro-P2A-EGFP vector was generated by substituting Cas9 open reading frame with a puromycin resistance cassette in the pL-CRISPR.SFFV.GFP plasmid (Addgene cat. no 57827). For sgRNA cloning into pU6-sgRNA-EF1α-puro-T2A-BFP, oligos were annealed in annealing buffer (200 mM potassium acetate, 60 mM HEPES-KOH pH 7.4, 4 mM magnesium acetate) and ligated into BstXI+BlpI (NEB) digested pU6-sgRNA-EF1α-puro-T2A-BFP. For sgRNA cloning into U6-sgRNA-SFFV-puro-P2A-EGFP, the oligos were phosphorylated by T4 PNK (NEB) and annealed in the T4 ligation buffer (NEB). The oligos and plasmid mixture was then subjected to digestion by BsmBI (NEB) and ligation by T4 ligase (NEB) (4 cycles of 42°C – 5 min and 16°C – 5 min, inactivation 55°C – 15 min). 3xFLAG-KANSL2, 3x-FLAG-KANSL3 and 3xFLAG-KAT8 open reading frames were expressed using the pLenti PGK Hygro plasmid. The FKBPF36V cassette was amplified from pCRIS-PITChv2-BSD-dTAG (BRD4) plasmid (Addgene cat. no 91792). The eSpCas9(1.1)-T2A-mCherry plasmid used for degron knock-in generation.
Radzisheuskaya A., Shliaha P.V., Grinev V.V., Shlyueva D., Damhofer H., Koche R., Gorshkov V., Kovalchuk S., Zhan Y., Rodriguez K.L., Johnstone A.L., Keogh M.C., Hendrickson R.C., Jensen O.N, & Helin K. (2021). Complex-dependent histone acetyltransferase activity of KAT8 determines its role in transcriptional regulation and cellular homeostasis. Molecular cell.
+ Open protocol
+ Expand
3

Lentiviral Vector Engineering for PD-L1 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
pL-CRISPR.SFFV.GFP(Addgene plasmid # 57827) was a gift from Benjamin Ebert47 (link). pMD2.G (Addgene plasmid # 12259) and psPAX2(Addgene plasmid # 12260) were gifts from Didier Trono. EX-U0767-Lv105 for overexpressing PD-L1 was purchased from GeneCopoeia. PD-1 (APC, clone MIH4), PD-L1 (APC, clone MIH1), IFNγ (PE-Cy7, clone B27), CD107a (PE, clone H4A3), CD3 (APC-H7, clone SK7), CD4 (PerCP, clone SK3), CD8 (PerCP, clone SK1) and CD8 (BV650, clone SK1) antibodies were purchased from BD Biosciences; IL-2 (BV421, clone MQ1-17H12) was purchased from BioLegend. TNFα (APC, clone MAb11) was purchased from eBioscience.
Zhang C., Peng Y., Hublitz P., Zhang H, & Dong T. (2018). Genetic abrogation of immune checkpoints in antigen-specific cytotoxic T-lymphocyte as a potential alternative to blockade immunotherapy. Scientific Reports, 8, 5549.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!