SKOV-3 cells were transfected using mature MiR-145-5p mimics to explore the modulating impact of miR-145-5p. Lipofectamine 3000 reagent was applied to the transfection, as per the manufacturer’s instructions. Nonhomologous miRNA mimics served as the negative control (NC). Cells underwent trypsinization, and 24 h after transfection, they were harvested for cell death and proliferation test. MiR-145-5p mimics and NC were purchased from RiboBio Co., Ltd. (Guangzhou, China).
Mir 145 5p mimic
Manufactured by RiboBio
Sourced in China
MiR-145-5p mimics are synthetic RNA molecules designed to mimic the function of the endogenous microRNA miR-145-5p. MiR-145-5p is a well-known tumor suppressor microRNA involved in the regulation of various cellular processes. The MiR-145-5p mimics can be used in research applications to investigate the biological functions and molecular mechanisms of miR-145-5p.
Automatically generated - may contain errors
Lab products found in correlation
Mir 145 5p inhibitor, by RiboBio (5 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Si nc, by RiboBio (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Mimic nc, by RiboBio (2 mentions)
Pcdna3, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Mir nc, by RiboBio (1 mentions)
Mirna mimic, by RiboBio (1 mentions)
Hct116, by American Type Culture Collection (1 mentions)
Plvx ires neo, by Takara Bio (1 mentions)
Si nc, by GenePharma (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Si sox9, by RiboBio (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Si klf5, by RiboBio (1 mentions)
11 protocols using mir 145 5p mimic
1
Modulation of SKOV-3 Cell Fate by miR-145-5p
2
Targeting LINC00052 and miR-145-5p in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering (si)RNAs against LINC00052 and a scrambled control siRNA used as a negative control (si-NC) were purchased from Guangzhou RiboBio Co., Ltd. miR-145-5p mimics (miR-145-5p-mimics), inhibitors (miR-145-5p-inhibitor), or corresponding scrambled controls (miR-NC) were synthesized by Guangzhou RiboBio Co., Ltd. siRNAs, miR mimics, miR inhibitors and their NC oligonucleotides (50 nM) were transfected using Lipofectamine™ 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) into the MDA-MB-231 and MCF-7 cells separately in 6-well plates of cells at 50–60 or 70–80% confluency, respectively, according to the manufacturer's protocol. Each well was transfected with 50 nM siRNAs. After 48 h of transfection at 37°C, the cells were collected for subsequent experiments. The sequences of siRNAs used are listed in Table I .
3
Establishing Oxaliplatin-Resistant Colorectal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines (HCT116, HT29, SW620, and SW480) and human normal colon epithelial cells (FHC), purchased from American Type Culture Collection (ATCC; Manassas, VA, USA), were cultured in Dulbecco's modified Eagle's medium (DMEM; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and 1% penicillin/streptomycin at 37°C in a humidified incubator with 5% CO2.
Oxaliplatin (OXA) was purchased from Meilun Biological Co., Ltd. (Dalian, China). OXA-resistant CRC cell lines (HCT116/OR and SW480/OR cells) were established by exposure to incremental doses of OXA (up to 2 μM) for 3 months in our laboratory. OXA was removed before the experiments were performed.
The specific small interference RNA (siRNA) targeting CBR3-AS1 (si-CBR3-AS1), siRNA negative control (si-NC), miR-145-5p mimics, miR-145-5p inhibitor, miRNA mimics, and inhibitor negative control were synthesized by Guangzhou RiboBio Co., Ltd. (Guangzhou, China). These molecular products were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). 48 h posttransfection, the transfection efficiency was analyzed by RT-qPCR analysis.
Oxaliplatin (OXA) was purchased from Meilun Biological Co., Ltd. (Dalian, China). OXA-resistant CRC cell lines (HCT116/OR and SW480/OR cells) were established by exposure to incremental doses of OXA (up to 2 μM) for 3 months in our laboratory. OXA was removed before the experiments were performed.
The specific small interference RNA (siRNA) targeting CBR3-AS1 (si-CBR3-AS1), siRNA negative control (si-NC), miR-145-5p mimics, miR-145-5p inhibitor, miRNA mimics, and inhibitor negative control were synthesized by Guangzhou RiboBio Co., Ltd. (Guangzhou, China). These molecular products were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). 48 h posttransfection, the transfection efficiency was analyzed by RT-qPCR analysis.
4
ANGPT2 Overexpression in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiR-145-5p mimics and NC mimics were purchased from Ribo Bio (Guangzhou, People’s Republic of China). Si-ANGPT2 and si-NC were ordered from GenePharma (Shanghai, China). Lentiviral expression vector pLVX-IRES-neo (Clontech, USA) was used to construct ANGPT2 overexpression vector (oe-ANGPT2), which was then used to infect GC cells with the empty pLVX-IRES-neo vector as control. For preparation, all cells were cultured in complete medium for at least 24 h, and then rinsed by phosphate buffered saline (PBS, pH7.4). Transfection was carried out using Lipofectamine2000 (Thermo Fisher Scientific, Inc.), and cells were cultured in corresponding mediums with 5% CO2 at 37 ℃. Blank group was taken as the control only with the transfection reagent.
5
Modulating circMET and CXCL3 in NSCLC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, the NSCLC cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) in 6-well plates at 50 to 60% confluence. The siRNAs against circMET and the CXCL3 mimics utilized for transfection were from GeneCopoeia (Shanghai, China). MiR-145-5p mimics were from RiboBio (Guangzhou, China). The adenovirus-mediated increase and knockdown of circMET or other RNA expression were designed by Genomeditech (Shanghai, China). Empty vectors were used as negative controls. Three independent experiments were performed.
6
Modulating Morf4l1 Expression via RNA Interference
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pcDNA 3.1/lncRNA Morf4l1, si-lncRNA Morf4l1, miR-145-5p mimics and miR-145-5p inhibitor were obtained from RiboBio (China). Empty vector (pcDNA 3.1), si-NC, mimics NC and inhibitor NC were used as a negative control (NC). The transfected plasmid was transfected when the cells reached about 70–80% fusion in a 60 mm dish, and the cells were collected 48 h later.
7
Overexpression of SOX4 and Regulation of circ_VANGL1/miR-145-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of Sex-determining region Y-related high-mobility group box 4 (SOX4) was cloned into pcDNA3.1 (Invitrogen) to construct SOX4 overexpression vector, termed pcDNA3.1-SOX4 (pc-SOX4). 2 × 105 T24 and J82 cells were added into a 12-well plate. Then, 0.2 μg of pc-SOX4 or pc-NC was transfected into T24 and J82 cells using 0.5 μL of Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, US). Small interference RNA against circ_VANGL1 (si-circ) and its control (si-NC), miR-145-5p inhibitor and the negative control (NC inhibitor), miR-145-5p mimic, and the blank control (NC-mimic) were purchased from RIBOBIO (Guangzhou, China). These aforementioned oligonucleotides (0.5 μg) were transfected into T24 and J82 cells with 0.6 μL of Lipofectamine 3000 (Invitrogen).
8
SOX9 Regulation in Intestinal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Intestinal epithelial cell lines at the exponential growth phase were first digested and inoculated in a 6-well plate at a density of 1×105 cells/well, and then were incubated for subsequent transfections. The pcDNA3-Flag-SOX9 plasmid (OBiO, Shanghai, China), Si-SOX9, miR-145-5p mimic, miR-145-5p inhibitor, or corresponding negative controls (RiboBio, Guangzhou, China) were applied to cell transfection in accordance with different purposes of the respective experiments. All transfection processes were conducted using Lipofectamine™ 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA) according to relevant protocol. The transfected cells were incubated for 48 h or 72 h for the subsequent analyses. In addition, the transfection efficiency was evaluated via determining the distribution and localisation of the FLAG-llabeled plasmid using immunofluorescence.
9
MiR-145-5p Modulation and DUSP6 Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR‐145‐5p mimic and its negative control mimic (miR‐NC) and miR‐145‐5p inhibitor and its negative control inhibitor were purchased from RiboBio (Guangzhou, China). The sequences as follows: miR‐145‐5p mimic, 5′‐GUCCAGUUUUCCCAGGAAUCCCU‐3′ and 5′‐GGAUUCCUGGGAAAACUGGACUU‐3′; Negative control, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and 5′‐ACGUGACACGUUCGGAGAATT‐3′; miR‐145‐5p inhibitor, 5′‐AGGGAUUCCUGGGAAAACUGGAC‐3′; scrambled control, 5′‐CAGUACUUUUGUGUAGUACAA‐3′. The coding region of the DUSP6 mRNA was cloned into the pcDNA3.1(+) vector. The lentiviral vector expressing short hairpin RNA (shRNA) targeting TUG1 was designed and constructed by GenPharma (Shanghai, China). All cell transfection procedures were performed with Lipofectamine 2000 (Life Technologies Inc, Carlsbad, CA, USA).
10
Modulating miR-145-5p in Gastric Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AGS and SGC-7901 cells (1×105 per well) were seeded in six-well plates. After 24 hours, the cells were transfected with an miR-145-5p mimic, an miR-145-5p mimic negative control, an miR-145-5p inhibitor, or an miR-145-5p inhibitor negative control (Ribo Bio, Guangzhou, People’s Republic of China), using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, Waltham, MA, USA) and following the manufacturer’s protocol. After transfection, the cells were collected for future examination and the effects of miR-145-5p transfection were determined by quantitative real-time polymerase chain reaction (qRT-PCR) at 24 hours posttransfection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!