The largest database of trusted experimental protocols

Pmscv ires gfp

Manufactured by Addgene

The PMSCV-IRES-GFP is a plasmid vector that contains an internal ribosome entry site (IRES) and a green fluorescent protein (GFP) reporter. It is commonly used for the simultaneous expression of two proteins from a single mRNA transcript.

Automatically generated - may contain errors

5 protocols using pmscv ires gfp

1

Optimized NUDT21 and CD19 Expression Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
NUDT21 codon-optimization was performed based on the NUDT21 full-length cDNA sequence (Ensembl NUDT21-201, ENST00000300291.10) to exclude EcoRI, XhoI and sgNUDT21.336 target sequences and synthesized with terminal 5’ EcoRI and 3’ XhoI sites using gBlock synthesis (IDT) (Supplementary Table 10). NUDT21 sgRNA-resistant (NUDT21sgRes) was subcloned into Empty vector (EV) pMSCV-IRES-GFP (Addgene #9044) via EcoRI and XhoI sites. Cas9+ NALM6 BCP-ALL cells were co-transduced with amphotrophic virus harboring either pMSCV-IRES-GFP;pLRCherryv2.1-sgROSA, pMSCV-NUDT21sgRes-IRES-GFP;pLRCherryv2.1-sgROSA, pMSCV-IRES-GFP;pLRCherryv2.1-sgNUDT21.336 or pMSCV-NUDT21sgRes-IRES-GFP;pLRCherryv2.1-sgNUDT21.336 and cultured for six days prior to flow cytometry, then cultured for a further five days. Fitness was assessed by calculating the percentage GFP+mCherry+ cells at day 6 and day 11 post-transduction.
Full length (FL) CD19 cDNA (Ensembl CD19–202, ENST00000538922.8) including (CD19FL) or excluding (CD19ΔUTR) the 3’ UTR sequence was synthesized using gBlock synthesis (IDT) then subcloned into pMSCV-IRES-GFP (Addgene #9044) via Gibson Assembly (New England BioLabs, E2611) (Supplementary Table 10). Cas9+ Reh cells were co-transduced with amphotrophic virus harboring either pMSCV-IRES-GFP, pMSCV- CD19ΔUTR-IRES-GFP or pMSCV- CD19FL-IRES-GFP. Cells were cultured for 72-hours prior to flow cytometry.
+ Open protocol
+ Expand
2

CRISPR-Mediated Gene Manipulation in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A single FLAG-tag was added to the N-terminus of the cDNAs of yeast ASP1 or zebrafish zASPG. The cDNAs were inserted into a modified pTRIPZ lentiviral vector (Dharmacon) or pMSCV-IRES-GFP (Addgene). Guide RNAs against human glutamine synthetase (sgGLUL-1, sgGLUL-2 and sgGLUL-3) were cloned into pLentiCRISPR V2 vector. For CRISPR rescue experiment, mouse Glul cDNA was cloned into pTURN-hygro retroviral expression vector, and HA tag was added to the C-terminus. Human ASRGL1 cDNA was cloned into pMSCV-puro retroviral expression vector (Clontech). Lentiviral particles were produced in 293T cells by using psPAX2 and pMD.2 packaging plasmids (Addgene). Retroviral particles were produced in 293T cells by using pcleo and pCMV-VSV-G packaging plasmids (gift from Scott Lowe). Cells were infected with viral supernatant in presence of 6 μg/mL of polybrene overnight and subjected to puromycin (2 μg/mL) or hygromycin (200 μg/mL) selection, or GFP sorting.
+ Open protocol
+ Expand
3

Cloning TET3 and RUNX3 Expression Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
To construct the TET3-mCherry and Runx3-blue expression plasmids, the open reading frames of TET3 and RUNX3 were amplified by PCR using the primers listed in Supp. Table 1. The PCR products were cloned into the pMSCV-IRES-GFP (86537, addgene, Cambridge, MA) pMSCV-IRES-mCherry (80139, addgene) and pMSCV-IRES-Blue FP (52115, addgene) vectors using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA).
+ Open protocol
+ Expand
4

Retroviral Vectors for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The retroviral vector p-MSCV-IRES-GFP was obtained from Addgene (Addgene plasmid 20672). Myristoylated Akt1 (mAkt) was previously described (Skeen et al., 2006 (link)) and was inserted in the Sal1 and Xho1 of p-MSCV-IRES-GFP. The retroviral vector p-MSCV-Skp2-IRES-GFP was kindly provided by Michael Deininger and was previously described (Agarwal et al., 2008 (link)). The retroviral vector p-MSCV-p53-IRES-GFP was kindly provided by Dean Felsher and was previously described (Giuriato et al., 2006 (link)).
+ Open protocol
+ Expand
5

Retroviral Knockdown and Overexpression in HPC7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For knockdown experiments, shRNA fragments were cloned into pMSCV/LTRmiR30-PIG (pLMP, Open Biosystems): Luciferase (control, 5’ CACGTACGCGGAATACTTCGAA 3’, [30 (link)]), Gata2 (5’ CGCCGCCATTACTGTGAATATT 3’, [31 (link)]). For overexpression experiments, the mouse Gfi1 cDNA was inserted into pMSCV-ires-GFP (Addgene plasmid 20672), with the empty vector used as a control. Retrovirus was produced using the pCL-Eco Retrovirus Packaging Vector (Imgenex) in 293T cells.
HPC7 cells were infected with retrovirus by centrifugation at 800 xg at 32°C for 1.5 hours with 4 μg/ml polybrene (Sigma), after which the retroviral supernatant was replaced with fresh media and cells were cultured as normal. Transduction efficiency was monitored by flow cytometry for GFP.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!