Allelic and genotypic frequencies were determined by allelic discrimination assays with probes TaqMan (c_ 2259574_10). Amplification was carried out in the StepOne real-time PCR ThermoCycler (Applied Biosystems®) using the TaqMan Universal Master Mix II reaction mixture. Thermal cycling conditions consisted of initial denaturation at 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds each, at 60°C for one minute each, and 60°C for 30 seconds each.
Stepone real time pcr thermocycler
Manufactured by Thermo Fisher Scientific
Sourced in United States
The StepOne Real-Time PCR thermocycler is a laboratory instrument designed for performing real-time polymerase chain reaction (PCR) analysis. It is capable of thermal cycling and detecting fluorescent signals to quantify nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Power sybr green master mix, by Takara Bio (2 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (1 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (1 mentions)
Rneasy plant mini kit, by Tiangen Biotech (1 mentions)
Miscript sybr green qpcr kit, by Qiagen (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Miscript 2 rt kit, by Qiagen (1 mentions)
Qiazol, by Qiagen (1 mentions)
Tb green premix ex taq 2 tli rnaseh plus, by Takara Bio (1 mentions)
Rnaprep pure plant plus kit, by Tiangen Biotech (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
6 protocols using stepone real time pcr thermocycler
1
Genetic Polymorphism Determination
2
Quantification of Inflammatory Markers in Gingival Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from gingival samples using the TRIzol reagent (Invitrogen, São Paulo, Brazil). The reverse transcription was performed using SuperScript IV Reverse Transcriptase (Invitrogen, São Paulo, Brazil) following the manufacturer’s instructions.
Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in StepOne Real-Time PCR thermocycler (Applied Biosystems,Warrington, UK) using SYBRR Green Master Mix (Applied Biosystems, Warrington, UK), as indicated by the manufacturer. The relative gene expression was determined using the 2-ΔΔCt method [16 (link)], withGAPDH (S-GGACCAGGTTGTCTCCTGTG/A-CATTGAGAGCAATGCCAGCC) as the housekeeping gene. The primers pairs used in this study were: TNF-α (S-CGGGGTGATCGGTCCCAACAAG/ A-GTGGTTTGCTACGACGTGGGC), IL1-β (S-TGCTGTCTGACCCATGTGAG/ A-CCAAGGCCACAGGGATTTTG), COX-2 (S-TCCAGTATCAGAACCGCATTGCCT/A AGCAAGTCCGTGTTCAAGGAGGAT), iNOS (S-AGGCACAAGACTCTGACACC/ A-GGTAGGGTAGAGGAGGGGAG), RANK (S-AGGGAAAACGCTGACAGCTAA/ A-CCAACACAATGGTCCCCTGA), and RANKL (S-GCCAACCGAGACTACGGCAA / A-GAACATGAAGCGGGAGGCG) .
Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in StepOne Real-Time PCR thermocycler (Applied Biosystems,Warrington, UK) using SYBRR Green Master Mix (Applied Biosystems, Warrington, UK), as indicated by the manufacturer. The relative gene expression was determined using the 2-ΔΔCt method [16 (link)], with
3
Transcriptomic Analysis of Z. xanthoxylum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An RNAprep Pure Plant Kit (Tiangen) was used to isolate total RNA of leaves from each plant and first-strand cDNA was synthesized from the RNA by using a PrimeScript™ RT Master Mix Kit (TaKaRa). qRT-PCR was performed in triplicate on three bioreplicates using Power SYBR™ Green Master Mix (TaKaRa Biotechnology, China) on a StepOne Real-Time PCR Thermocycler (Applied Biosystems). All kits were used according to the manufacturer instructions. Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast ) was used for primer design according to the following criteria: PCR amplicon lengths of 80–120 bp, Tm of 60 ± 1℃ and GC contents of 45–60%. The primers employed were listed in Table S2 . The comparative cycle threshold method (ΔΔCT) was used to calculate relative expression levels, and ZxACTIN (GenBank: EU019550.1) from Z. xanthoxylum was used as the reference gene.
4
RT-qPCR Analysis of IAA-Treated Seedlings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RT-qPCR analysis, 7-d-old light-grown or 4-d dark-grown 1 6-d lightgrown seedlings of different genotypes were treated with or without 1 mM IAA for 1 h. Roots or hypocotyls were collected and immediately frozen in liquid nitrogen and stored at 280°C. Total RNA was isolated using an RNeasy plant mini kit (TIANGEN) and then subjected to first-strand cDNA synthesis according to the manufacturer's protocol (TaKaRa Biotechnology). RT-qPCR was conducted with Power SYBR green master mix (TaKaRa Biotechnology) and finished on a StepOne real-time PCR thermocycler (Applied Biosystems). ACTIN2 was used as the internal control gene. Primer-BLAST (https://www. ncbi.nlm.nih.gov/tools/primer-blast) was used for primer design. A standard curve and efficiency test were performed for each set of primers (Supplemental Table S1).
5
miRNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of miRs was performed using QIAzol and miRNeasy mini kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Reverse transcription of RNA was performed with miScript II RT kit (Qiagen). Later, quantitative real time PCR was performed using the miScript SYBR Green qPCR kit (Qiagen) in a StepOne Real-Time PCR thermocycler (Applied Biosystems, Foster City, CA, USA). The results were calculated using the ΔΔCq method [78 (link)]. Primers and PCR programs are described in Supplementary Table S1 . U6 small nuclear RNA (RNU6) was used as housekeeping miR and bidistilled water was used instead of cDNA as a negative control.
6
Quantification of SAUR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Shoot, root, and whole plant of 7-day-old seedlings or shoots of 14-day-old seedlings were collected and flash-frozen in liquid nitrogen. Total RNA was isolated by using an RNAprep Pure Plant Plus Kit (TIANGEN, Beijing, China) and cDNA was synthesized using a PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa Biotechnology, Shiga, Japan). RT-qPCR was performed in triplicate or in duplicate on three bio-replicates using TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa Biotechnology) on a StepOne Real-Time PCR Thermocycler (Applied Biosystems, Waltham, MA, USA). Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast ) was used for primer design and primer efficiency was verified by melt curve analysis. The transcript level of SAUR19 subfamily genes (SAUR19-24) was analyzed by using homologous sequences in these genes for primer design. ACTIN 2 (ACT2) was used as the internal control gene. Primers are listed in Supplemental Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!