E z n a hp total rna kit

Total RNA was extracted using the E.Z.N.A. HP Total RNA kit (Omega Bio-tek, United States). The cDNA synthesis was carried out using 0.5 μg of RNA with the Prime Script RT master mix (Perfect Real Time; TaKaRa, Japan). Quantitative real-time PCR analysis was conducted in triplicate on LightCycler 480 (Roche, Mannheim, Germany) using SYBR Premix Ex Taq (TaKaRa, Japan) and the datas were normalized based on the expression of GAPDH RNA. The results were calculated utilizing the ΔΔCT methods. The primers for selected genes were as follows:
h-iNOS: 5′-AGCTGAACTTGAGCGAGGAG-3′, 5′-GGAAAAGACTGCACCGAAGA-3′;
h-TNF-α: 5′-GTGCTTGTTCCTCAGCCTCTT-3′, 5′-ATGGGCTACAGGCTTGTCACT-3′;
h-IL-10: 5′-ACCTGCCTAACATGCTTCGAG-3′, 5′-CTGGGTCTTGGTTCTCAGCTT-3′;
h-sPLA2-IIA: 5′-TGACGACAGGAAAGGAAGCC-3′, 5′-CTGCTCCCCGAGTTGCTAAA-3′;
h-GAPDH: 5′-GCACCGTCAAGGCTGAGAAC-3′, 5′-TGGTGAAGACGCCAGTGGA-3′;
m-IL-6: 5′-CCAAGCCTTATCGGAAATGA-3′, 5′-TTTTCACAGGGGAGAAATCG-3′;
m-TNF-α: 5′-CGGTGCCTATGTCTCAGCCT-3′, 5′-GAGGGTCTGGGCCATAGAAC-3′;
m-sPLA2-IIA: 5′-CTGTTGCTACAAGAGCCTGG-3′, 5′-GCCGTTTCTGACAGGAGTTC-3′;
m-GAPDH: 5′-TGTGTCCGTCGTGGATCTGA-3′, 5′- TTGCTGTTGAAGTCGCAGGAG-3′.

Recombinant human TGF‐β protein was obtained from PeproTech (Rocky Hill, NJ, USA). Primary antibodies against GSK‐3β (27C10), GSK‐3β (Ser9), AKT (C67E7), p‐AKT (Ser473) were purchased from Cell Signaling Technology (Danvers, MA, USA). Primary antibody against SP1(G447) was obtained from Bioworld (Bioworld Technology, Minneapolis, MN, USA). Protein A/G sepharose and primary antibodies against ubiquitin (SC‐166553) and β‐actin (SC‐130300) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Phycoerythrin (PE)‐labelled antibody against ULBP1 and ULBP2 were obtained from R&D (San Diego, CA, USA). Horseradish peroxidase (HRP)‐conjugated secondary antibody, Alexa Fluor 488‐conjugated secondary antibody, 4′, 6‐diamidino‐2‐phenylindole (DAPI) and lipofectamine 2000 were purchased from Invitrogen (Carlsbad, CA, USA). Proteasome inhibitor MG132 was obtained from Sigma‐Aldrich (St Louis, MO, USA). PrimeScript RT reagent Kit and SYBR Premix Ex TaqTM were products of TaKaRa. E.Z.N.A HP Total RNA Kit was purchased from Omega Bio‐Tek (Doraville, GE, USA). Smart pool siRNA against human SP1 (siSP1), GSK‐3β (si‐GSK‐3β) and control (siNC) were purchased from RiboBio (Guangzhou, China). ERK inhibitor PD98059, p38 MAPK inhibitor SB203580, PI3K inhibitor LY294002 and TGF‐β type I receptor inhibitor SB431542 were obtained from Sigma‐Aldrich.

Total RNA was extracted using E.Z.N.A. HP Total RNA kit (Omega Bio-Tek, Norcross, USA), and total RNA concentration was determined in a NanoDrop1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, USA). ReverTra Ace reverse transcriptase (Toyobo, Osaka, Japan) and miRNA-specific were used to synthesize cDNA. The stem-loop RT-qPCR method was performed, stem-loop RT primers for miR-146b were designed [12 (link)], and U6 snRNA was used as an internal control [16 (link)]. RT-qPCR was performed using SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) and ABI StepOne Plus real-time PCR system (Applied Biosystems, Foster City, USA). All reactions were carried out in triplicate. Relative quantification was calculated using 2^-ΔΔCt.

Total RNA was extracted from cell pellets using E.Z.N.A.® HP Total RNA kit (Omega Bio-Tek, Norcross, GA), and reverse-transcribed to cDNA using Maxima cDNA synthesis kit (Thermo Fisher) from 0.5-1 ug of mRNA. qRT–PCR assays were performed using ssoFast Evagreen supermix (BioRad) in CFX96^TM Real-Time PCR Detection Systems (BioRad, Hercules, CA). The primers used were: APJ, forward: 5′-TGGTGCTCTGGACCGTGTTT-3′; reverse: 5′-TGAGGTAGCTGCTGAGCTTG-3′; GAPDH, forward: 5′–GACCCCTTCATTGACCTCAAC–3′; reverse: 5′–CTTCTCCATGGTGGTGAAGA–3’. The thermal reaction program was: 30 sec at 95°C, 40 cycles of 5 sec at 95°C, and 5 sec at 55°C. APJ mRNA level relative to GAPDH mRNA was calculated using the ΔΔCt method [50 (link)].

Total RNA was isolated using RNeasy Plus Mini Kit (Qiagen) or E.Z.N.A. HP Total RNA Kit (Omega Bio-tek) and reverse transcribed to cDNA with High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Quantitative real-time polymerase chain reaction (qPCR) was performed on 7500 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific) using TaqMan Universal MasterMix and TaqMan gene expression assays for human α1-subunit of Na⁺,K⁺-ATPase (No. Hs00167556_m1) and human α3-subunit of Na⁺,K⁺-ATPase (No. Hs00958036_m1). Expression of target gene was normalized to expression of cyclophilin (PPIA, No. Hs99999904_m1), which was used as an endogenous control. Efficiency of PCR was estimated with LinRegPCR software (2018.0) (Ramakers et al. 2003 (link); Ruijter et al. 2009 (link); Tuomi et al. 2010 (link)).

TSA, SAHA and actinomycinD (Act-D) were obtained from Sigma-Aldrich (St Louis, MO). Primary antibodies against p-STAT3, STAT3, Foxo3a were obtained from Cell Signaling Technology (MA, USA). Primary antibodies against P-gp, PXR, CAR, β-catenin, α-tubulin were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Horseradish peroxidase (HRP)-conjugated secondary antibody, Alexa Fluor 594 conjugated secondary antibody, DAPI and lipofectamine 2000 were purchased from Invitrogen (Carlsbad, CA, USA). PrimeScript^® RT reagent Kit and SYBR^® Premix Ex TaqTM were products of TaKaRa. E.Z.N.A^® HP Total RNA Kit was bought from Omega Bio-Tek (Doraville, USA). Smartpool siRNA against human STAT3 was obtained from RIBOBIO.