Sigmaspin sequencing reaction clean up kit

Single guide RNA (sgRNA) targeting the zebrafish eef1a2 gene was designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and the oligonucleotides TAGGATAAGTTGAAGGCTGAGA and AAACTCTCAGCCTTCAACTTAT purchased from Integrated DNA Technologies (IDT) with a 5′ phosphate modification to increase ligation efficiency. The sgRNA construct was made by inserting annealed pairs of oligonucleotides into Bsal (New England Biolabs) digested pDR274 (Addgene #42250) backbone. The sgRNA plasmid was used as a template to amplify gRNA sequences, which were then transcribed using the Ambion MAXIscript T7 kit (Thermo Fisher Scientific). Cas9 mRNA was synthesised by transcribing NotI-digested pCS2-nCas9n (Addgene #47929) using the SP6 mMESSAGE mMACHINE kit (Thermo Fisher Scientific) to generate capped mRNA. Purification of synthesised mRNA was performed using SigmaSpin sequencing reaction clean-up kit (Sigma–Aldrich) according to the manufacturer’s instructions.

Probes for whole mount in situ hybridization (WISH) were amplified from zebrafish cDNA by PCR, cloned into the pGEM-T vector (Promega) and verified by sequencing. Antisense and sense (control) probes were synthesized in vitro with SP6 or T7 RNA polymerases (Roche), with the addition of the DIG RNA Labeling Mix (Roche). Probes were purified with the Sigma-Spin Sequencing Reaction Clean-Up Kit (Sigma-Aldrich). WISH was performed as described in Thisse and Thisse (2008 (link)), with the addition of 5% dextran sulfate (w/v; Sigma-Aldrich) to the hybridization mix for improved signal-to-noise ratio.