In situ hybridization of cDCBLD2 (CACATCCATCACCTTGTTTA+CY3/FAM), miRNA 345-5p (GAGCCCTGGACTAGGAGTCAGC+CY3) and 18s (genepharma, China) was performed using fluorescent-labeled specific probes which was from genepharma (China). The experiment was completed using RNA fluorescence in situ hybridization (FISH) kit (genepharma, China) according to the manufacturer's instructions. Images were obtained by Invitrogen™EVOS™ FL Auto 2 Imaging System (Thermo Fisher Scientific, Waltham, MA). The correlation of co localization fluorescence was analyzed using image J and Pearson test was performed.
Fish kit
Manufactured by GenePharma
Sourced in China
The FISH kit is a laboratory equipment designed for Fluorescence In Situ Hybridization (FISH) analysis. The kit contains the necessary reagents and materials to perform FISH experiments, which is a widely used cytogenetic technique for the detection and visualization of specific DNA sequences within cellular samples.
Automatically generated - may contain errors
Lab products found in correlation
Fluorescence microscope, by Leica camera (5 mentions)
4 6 diamidino 2 phenylindole (dapi), by Beyotime (4 mentions)
Lsm800 confocal microscope, by Zeiss (3 mentions)
4 6 diamidino 2 phenylindole (dapi), by Solarbio (3 mentions)
Laser scanning microscope, by Zeiss (2 mentions)
Fluorescence microscope, by Zeiss (2 mentions)
Fish probe, by GenePharma (2 mentions)
Tcs sp5 2 confocal microscope, by Leica Microsystems (2 mentions)
Laser scanning confocal microscope, by Nikon (2 mentions)
Lsm880 nlo confocal microscope, by Leica Microsystems (2 mentions)
Paris kit, by Thermo Fisher Scientific (2 mentions)
Image pro plus 6, by Media Cybernetics (2 mentions)
Confocal microscope, by Leica camera (2 mentions)
Dapi 4 6 diamidino 2 phenylindole, by Beyotime (2 mentions)
Fitc labeled hotair, by GenePharma (2 mentions)
Fv3000 microscope, by Olympus (2 mentions)
Fish probe, by RiboBio (2 mentions)
Lsm 700, by Zeiss (2 mentions)
Invitrogen evos fl auto 2 imaging system, by Thermo Fisher Scientific (1 mentions)
Tcs sp8 mp, by Leica camera (1 mentions)
116 protocols using fish kit
1
In Situ Hybridization of cDCBLD2, miRNA 345-5p, and 18s
2
RNA-FISH Analysis of miR-203 in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cy3-labeled HCP5 probe and FAM-labeled miR-203 were purchased from GenePharma (Shanghai, China). A549 cells (1 × 103) were seeded on glass coverslips in the 6-well plate and grown overnight at 37 °C. Then, we washed cells twice with 1 × PBS and fixed them in 4% paraformaldehyde for 15 min. Permeabilization and hybridization followed by washing with sodium citrate buffer (SSC) according to the manufacturer's instructions of the FISH Kit (GenePharma, Shanghai, China). The nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI, GenePharma, China) and finally images were obtained by confocal microscope (Leica TCS SP8 × & MP). The sequences of RNA-FISH probes are listed in Table S5 .
3
Subcellular Localization of lncRNA CUTALP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subcellular distribution of lncRNA CUTALP was assessed using a FISH kit according to the manufacturer's instructions (GenePharma, Shanghai, China). In brief, pPDLSCs were fixed in 4% paraformaldehyde and hybridized with a 10 μM Cy3-labeled lncRNA CUTALP probe in a hybridization buffer. Cells were washed with saline sodium citrate and counterstained with DAPI. Images were obtained using a fluorescence microscope.
4
Detecting Circular RNA and MicroRNA in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells were seeded on cell slides at the bottom of a 24-well plate and fixed with 4% paraformaldehyde. The CY3-labeled probe targeted the hsa_circ_0096442 junction site, and the FITC-labeled hsa-miR-326 probes were designed and synthesized by Geneseed (Guangzhou, China). Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI). The signals of the probes were detected using a fluorescence in situ hybridization (FISH) kit (GenePharma, Shanghai, China) according to the manufacturer’s instructions.
5
Fluorescent In Situ Hybridization for Circular RNA and MicroRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Probes targeting hsa-circ-0048117 and miR-140 were designed and synthesized by GenePharma (Shanghai, China). Macrophages were seeded on a cover slip, fixed with 4% paraformaldehyde and penetrated with Triton-X. Mixed the probes and macrophages in incubator at 37 °C overnight for hybridization according to the protocols. DAPI was used for nuclei staining in the dark for 10 min. The signals of probes were detected by the FISH Kit (GenePharma, China) after washing with PBS. Images were acquired by confocal microscope of Leica (Zeiss LSM880 NLO, Leica Microsystems, and Germany). The sequence of probes are as follows: hsa-circ-0048117: 5ʹ-GGTACTT CATGTATCTGTGTACATGATGCC-3ʹ, miR-140: 5ʹ-TACCATAGGGTAAAACCAC TG−3ʹ.
6
Subcellular Localization of Lnc-UC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subcellular localization of Lnc-UC was determined using a FISH kit according to the manufacturer’s protocol (GenePharma, Shanghai, China). In brief, BMDMs were fixed in 4% paraformaldehyde and hybridized with Lnc-UC probe (10 nM) in a hybridization buffer. After washing with saline sodium citrate, cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) and the images were captured by using a laser scanning microscope (Carl Zeiss, Oberkochen, Germany).
7
Visualization of circTADA2A and miR-638 by FISH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The assay was performed as previously described (20 (link)). Specific probes targeting circTADA2A or miR-638 were synthesized by Shanghai GenePharma Co., Ltd. The assay was conducted using a FISH kit (Shanghai GenePharma Co., Ltd.) according to the manufacturer's instructions. Cy3-labeled circTADA2A and Dig-labeled locked nucleic acid miR-638 probes (Shanghai GenePharma Co., Ltd.) were measured using the aforementioned FISH kit, followed by visualization with a confocal microscope (Carl Zeiss AG).
8
Subcellular localization of lncRNA Platr4 in BMDMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subcellular distribution of Platr4 was assessed using a FISH kit according to the manufacturer's instructions (GenePharma, Shanghai, China). In brief, BMDMs were fixed in 4% paraformaldehyde, and hybridized with 10 nM Platr4 probe in a hybridization buffer. Cells were washed with saline sodium citrate and counterstained with DAPI. Images were obtained using a laser scanning microscope (Carl Zeiss, Oberkochen, Germany). The forward and reverse sequences of FISH probe were 5'-CTGTGACTTCTCCAGGGCAG and 5'-GGACAATCTCACGTGCTCCA, respectively.
9
Localization of UPK1A-AS in Tumor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The distribution of UPK1A-AS in tumor cells was detected by FISH Kit (Gene Pharma, Guangzhou, China) according to the manufacturer’s instructions. In brief, the cells were fixed and then hybridized with Cy3-labeled UPK1A-AS1 probes overnight at 37 °C. DAPI was used to stain the nuclei. The fluorescence signals were captured by confocal microscopy (Carl Zeiss AG, Germany). The sequences of the probes are listed in Table S1 .
10
Circular RNA and miRNA Detection in Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The probes and FISH Kit used in this assay were purchased from GenePharma. First, tissues were fixed in 4% paraformaldehyde, dehydrated in ethanol, embedded in paraffin and sliced into sections. Next, the sections were treated sequentially with dimethylbenzene xylene (15 min), anhydrous ethanol (5 min), alcohol (10 min) and proteinase K (30 min). Then the sections were hybridized at room temperature in hybrid solution (1 μl) containing hsa_circ_0001367 or miR-431 probes overnight. After washing, cell nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; Invitrogen) at room temperature for 5 min. Finally, images were captured with a fluorescence microscope (Olympus, Tokyo, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!