Cfx connect system

Total RNA was isolated using EuroGOLD RNA Pure according to the manufacturer’s instructions. The total RNA concentration was quantified spectrophotometrically at 260 nm in a Beckman Coulter DU^®730 spectrophotometer (Fullerton, CA, USA) and purity was evaluated by measuring the ratio A260/A280. Total RNA (1 μg) was reverse transcribed using the High Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Waltham, MA, USA) according to the manufacturer’s suggestions in a Thermal Cycler (Gene Amp PCR System 2400, PerkinElmer, Boston, MA, USA). Quantitative PCR was performed in a CFX connectTM system (Bio-Rad, Hercules, CA USA). All primer pairs were designed using the software Beacon Designer 8.12 (PREMIER Biosoft International, Palo Alto, CA, USA) and were synthesized by Sigma Genosys Ltd. (London Road, UK). Primer sequences are specified in Table 2. 18S and HPRT were used as reference genes. PCR amplification was performed in 15 μL reaction volume containing 25 ng of cDNA, 1 × iQ SYBR Green Supermix, and 250 nM gene specific sense and antisense primers and 100 nM primers for 18S. The data were analyzed using a Bio-Rad CFX manager (version 3.1).

For transient ABA or drought treatment, the 3-week-old seedlings were transferred into Hoagland medium supplemented with 100 μM ABA or placed in a petri dish on a laboratory bench, respectively. Then the samples were collected at indicated time point, and were frozen immediately by liquid nitrogen. Total RNA was extracted using a Plant Total RNA Isolation Kit (Sangon Biotech, Shanghai, China, No. SK8631) following the manufacturer’s instructions. Approximately 1 μg of total RNA was used for cDNA synthesis using a PrimeScript^TM RT reagent kit (TaKaRa, Japan, Cat#RR047A). For qPCR, a total volume of 10 μL reaction mixture was used containing 5 μL of 2 × SYBR Green Master Mix (BioRad, United States), 0.5 μL of 5 × diluted cDNA, 0.25 μL of each primer, and 4 μL of ddH₂O. Amplification was performed using a CFX Connect^TM system (Bio-rad, United States). The amplification program consisted of one cycle of 95°C for 5 min, followed by 50 cycles of 95°C for 15 s, 60°C for 20 s, and 72°C for 20 s. The fluorescent product was detected at the third step of each cycle. The expression level of each gene was calculated using the 2^–ΔΔCT method (Livak and Schmittgen, 2001 (link)). All analyses were repeated three times using biological replicates. The gene BnaGAPDH (BnaC05g12400D) was used as the internal control. All primers are listed in Supplementary Table S2.

Total RNA was isolated from cultured podocytes using TRIzol (Sigma-Aldrich) according to the manufacturer’s instructions. First-strand cDNA was synthesized from 1 μg of total RNA using a ReverTraAce^® qPCR RT Master Mix (TOYOBO, Tokyo, Japan) according to the manufacturer’s protocol. The cDNA was then amplified using SYBR Green PCR Master Mix (TOYOBO) for real-time PCR. The following primer pairs were used to assay the expression of α-actinin-4, β1 integrin, and nephrin: α-actinin-4: 5′-actaccacgcagcgaacc-3′ (forward) and 5′-tcccctgaaatgacctcc-3′ (reverse); β1 integrin: 5′-gaggttcaatttgaaattag-3′ (forward) and 5′-ggctctgcactgaacacatt-3′ (reverse); and nephrin: 5′-gaggaggatcgaatcaggaa-3′ (forward) and 5′-ggtccacttctgctgtgcta-3′ (reverse). Real-time PCR was carried out on a CFX Connect^TM system (Bio-Rad), and the data were analyzed following the ΔΔC_T method.

Total RNA was extracted using a Plant Total RNA Isolation Kit (Sangon Biotech, Shanghai, China, No. SK8631) following the manufacturer’s instructions. Approximately 1 μg of total RNA was used for cDNA synthesis using a PrimeScript^TM RT reagent kit (TaKaRa, Japan, Cat#RR047A). For qPCR, a total volume of 10 μl reaction mixture was used containing 5 μl of 2 × SYBR Green master mix (Cat# 172-5124, Bio-Rad), 0.5 μl of 5× diluted cDNA, 0.25 μl of each primer, and 4 μl ddH₂O. Amplification was performed using a CFX Connect^TM system (Bio-Rad, United States). The amplification program consisted of one cycle of 95°C for 5 min, followed by 50 cycles of 95°C for 15s, 60°C for 20 s, and 72°C for 20 s. The fluorescent product was detected at the third step of each cycle. The expression level of each gene was calculated using the 2^-ΔΔCT method (Livak and Schmittgen, 2001 (link)). All analyses were repeated three times using biological replicates. The ACTIN and GAPDH genes served as the internal control. All primers are listed in Supplementary Table S6.

Total RNA was isolated with TRIzol (Invitrogen, Waltham, MA, USA), and cDNA synthesis was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Waltham, MA, USA). Quantitative PCR was performed in triplicate with SYBR® Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA) and was detected by CFX ConnectTM System (Bio-Rad, Hercules, CA, USA). PCR conditions were 30 cycles of 94 °C for 15 s, 52 °C for 30 s, and 72 °C for 30 s. Data were analyzed using CFX Manager Software (Bio-Rad, Hercules, CA, USA). Experimental Ct values were normalized to MRPL32. The sequences of PCR primers (5′-3′) were CGCGGTCGCCAAAAAGAAAG and TACTTGCAGTCGGCTCCAAAC for MDK; CCTTATCAAGATGCGAACTCACA and CGGAGGTGTTCTATGAGCTGG for HIF-1α; CGGAGGTGTTCTATGAGCTGG and AGCTTGTGTGTTCGCAGGAA for HIF-2α; CGGAGGTGTTCTATGAGCTGG and AGCTTGTGTGTTCGCAGGAA for MRPL32.

Total RNA was isolated from primary microglia or BV2 cells using TRIfast (VWR, Darmstadt, Germany) according to the manufacturer’s instructions. RNA concentrations were analyzed using a photometer (Eppendorf BioPhotometer D30). cDNA synthesis was performed using a ProtoScript II First Strand cDNA Synthesis Kit (New England BioLabs) according to the manufacturer’s instructions. A CFX Connect^TM System (Bio-Rad, München, Germany) was employed for quantitative RT-PCR (qPCR) analyses. Samples were prepared using a Luna Universal qPCR Master Mix (New England BioLabs, Ipswich, MA, USA). All qPCR reactions were performed in duplicates, and the results were analyzed using the CFX Connect^TM System software and the comparative CT method. Data are presented as 2^−∆∆CT for the gene of interest (Cd74) normalized to the housekeeping gene Gapdh and presented as percent of the control groups. The following primers were used: Cd74 for 5′-CCGCCTAGACAAGCTGACC-3′, Cd74 rev 5′-ACAGGTTTGGCAGATTTCGGA-3′ (NM_010545.3), Gapdhfor 5′-AGGTCGGTGTGAACGGATTTG-3′, and Gapdhrev 5′-TGTAGACCATGTAGTTGAGGTCA-3′ (NM_008084).

Total RNA was isolated with TRIZOL reagent (Invitrogen; Carlsbad, CA), and cDNA was synthesized in a reaction mixture containing MMLV Reverse Transcriptase (Promega; Madison, WI), RNase inhibitor, random primers, dNTP and 0.1% BSA for 1 hour at 42 °C. Quantitative real-time PCR was performed in triplicates on 96-well optical plates using qPCR Mastermix (Enzynomics; Daejeon, South Korea), and fluorescence was detected by CFX ConnectTM System (Bio-Rad). PCR conditions were 40 cycles of 95 °C for 10 sec, 53 °C for 15 sec, and 72 °C for 20 sec. Data were analyzed with the CFX Manager Software (Bio-Rad), and the mRNA values of targeted genes were normalized to GAPDH expression. The sequences of PCR primers are summarized in Supplementary Table 1.