Nextseq instrument

RNA polymerase II (Pol II) ChIP-seq was performed essentially with 5 biological replicates as previously described [36 (link)]. Fifteen micrograms of chromatin was immunoprecipitated overnight with 5 μg RNA Pol II antibody (Abcam, ab817) bound to protein A/G sepharose (Thermo Fisher, 10002D). Sequencing libraries were prepared by using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB, E7645) and sequenced (75 nt single-end) on an Illumina NextSeq instrument.

Total RNA was isolated, ribosomal RNA was removed, and mRNA libraries were generated with the ScriptSeq V2 RNA-Seq Complete Gold Kit for Epidemiology (Epicenter). cDNA samples were pooled at equal nanomolar concentration and 150-base paired-end reads were generated on the Illumina NextSeq instrument. Sequences from each sample were trimmed of adapters using Trimmomatic [48 ]. Primer, rRNA, tRNA, phiX, and human contaminant sequences were removed using the Burrows-Wheeler Aligner (BWA) [49 (link)]. The resulting reads were termed clean and were used for further taxonomic and metabolic function analysis.

Cell lines over-expressing chromatin remodelers, including HDAC1 were characterized using RNA-sequencing (RNA-seq) and ChIP-sequencing (ChIP-seq). Data were generated and analyzed using established, published methods [28 (link), 29 (link)]. Briefly, RNA-sequencing libraries for MiaPaca-2 and Panc-1 cells were made using the Lexogen 3′ RNA-sequencing kit. They were pooled and sequenced on an Illumina NextSeq instrument with 75 bp single-end reads. Analysis used previously published methods including: Trimgalore for adapter trimming, fastqc for quality score assessment, STAR for alignment to hg38, HTSeq-gene to map reads to features, and DESeq2 for differential expression analysis. For ChIP-seq, HDAC1 over-expressing MiaPaca-2 cells were cross-linked, harvested, and DNA was precipitated using a commercial HDAC1 antibody (Invitrogen, PA1860). Libraries were constructed, pooled and sequenced using Illumina NovaSeq single end 75 bp reads. These data were generated and analyzed using published ENCODE protocols (https://www.encodeproject.org/documents/).

Collected oligos from each ROI were PCR amplified using a forward primer with the sequence CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT and a reverse primer with the sequence AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCT, where Xs represent custom Illumina i5/i7 unique dual indexing sequences to preserve ROI identity. PCR products were pooled and purified twice with AMPure XP beads (Beckman Coulter). PCR products for each analyte type (RNA and protein) were pooled and sequenced separately. Library concentration and purity were measured using a high sensitivity DNA Bioanalyzer chip (Agilent). Paired end (2 × 38 bp reads) sequencing was performed on an Illumina NextSeq instrument.

ATAC-seq was performed essentially with 3 biological replicates as previously described [37 (link)]. Briefly, 50,000 K562 cells were collected and incubated with transposase Tn5 at 37 °C. After 1-h incubation, tagmented DNA samples were amplified using the Nextera Index kit (Illumina, FC-121-1030). DNA fractions were size selected and purified using AMPure XP beads (Beckman Coulter, A63880) according to the manufacturer’s instruction. Libraries were sequenced in paired-end with 75-nt read length using the Illumina NextSeq instrument.