Plasmid constructs encoding mUNG1-CFP, mUNG2-CFP, mUNG2-YFP and YFP-RPA2 were described previously (19 (link)). The Helix-mut_1 mutation (6 nt deletion) was introduced into the UNG-expressing constructs by the Q5® Site-Directed Mutagenesis Kit (NEB), with forward (acaaggccgcggcgctgctcag) and reverse (ggatgcggacgagctgctcggc) primers, according to the manufacturer's instructions. All mutans were verified by DNA sequencing (Eurofins Genomics Sanger sequencing Service). U2OS cells were transfected with FuGENE® HD or X-tremeGENE™ HP (Roche), 10 mM hydroxyurea (final) was added one day post-transfection to induce visible RPA foci, and cells were examined after 24 h in a Zeiss LSM 510 laser scanning microscope with a Plan-Apochromat 63×/1.4 oil immersion objective. CFP was excited at 458 nm and detected at 470–500 nm, YFP was excited at 514 nm and detected between 530–600 nm.
Lsm 510 laser
Manufactured by Zeiss
Sourced in Germany
The LSM 510 laser is a core piece of equipment used in scientific and research laboratories. It is a confocal laser scanning microscope that allows for high-resolution imaging and analysis of samples. The LSM 510 utilizes laser technology to excite fluorescent markers within samples, enabling detailed visualization and examination of microscopic structures and processes.
Automatically generated - may contain errors
Lab products found in correlation
Zen 2009, by Zeiss (2 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Plan apochromat 63 1.4 oil, by Zeiss (1 mentions)
X tremegene hp, by Roche (1 mentions)
Goat anti mouse secondary antibody, by Thermo Fisher Scientific (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Vector Laboratories (1 mentions)
Goat anti rabbit secondary antibody, by Thermo Fisher Scientific (1 mentions)
Slowfade gold antifade reagent, by Thermo Fisher Scientific (1 mentions)
Hybriwell hbw20, by Grace Bio-Labs (1 mentions)
Fluorescein phalloidin, by Thermo Fisher Scientific (1 mentions)
Glass bottom dishes, by MatTek (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions)
Sc 12732, by Santa Cruz Biotechnology (1 mentions)
Sc 377460, by Santa Cruz Biotechnology (1 mentions)
16 protocols using lsm 510 laser
1
Plasmid Constructs for UNG and RPA Visualization
2
Chloride Dynamics in Ventral Tegmental Area
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three-hundred-micrometer-thick coronal brain sections corresponding to the VTA of C57Bl/6 and GAD65-GFP knock-in mice were incubated in artificial cerebral spinal fluid (126 NaCl, 2.5 KCl, 2 CaCl2, 2 MgCl2, 10 glucose, 26 NaHCO3, 1.25 NaH2PO4) containing 5 mM of the Cl− indicator N-6-methoxyquinolinium acetoethylester (MQAE; Invitrogen) for 30–40 min at 34 °C. MQAE fluorescence was excited using a Zeiss LSM510 laser-scanning microscope coupled to a femtosecond-pulsed Ti-Sapphire laser (Chameleon Ultra, Coherent, Santa Clara, CA) tuned at 750 nm (Gagnon et al, 2013 (link)). After a control period of 50 s, the perfusion solution was switched to artificial cerebral spinal fluid containing 15 mM KCl (osmolarity adjusted using mannitol) to reverse KCC2-mediated Cl− transport to force Cl− accumulation inside the cell leading to a quenching of the measured lifetime (Chorin et al, 2011 (link)). Briefly, following the results of previous studies (Digman et al, 2008 (link)), we converted the photon timing histograms of each acquired lifetime image to phazer plots. To compare between groups, the average lifetime slope corresponding to the peak change in MQAE fluorescence was determined and compared. Means were calculated for each group (n=6–9 animals) for analysis.
3
Quantifying Fluorescent Aβ in Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Macrophage cells containing fluorescent Aβ were imaged on a Zeiss LSM 510 Laser scanning confocal microscope using the 40x objective and an argon laser at 488nm excitation wavelength. Macrophages were viewed in two channels, the light channel and the fluorescent channel and microscope settings were saved and reused for consistency between experiments. Images were taken until 100+ macrophages were sampled. To analyze these images, we used a custom MATLAB script. This script uses defined cell size ratios and edge detection to pick out single cells and objects (up to 4 cells clumped together) and measures the average pixel intensity, max pixel intensity, and area of each object. This script thresholds out the background and subtracts this measurement from the average cellular pixel intensities. This script is available on GitHub at https://github.com/gclark304/fluorescent_image_analysis .
4
Microscopic Imaging of Fluorescent Seedlings
5
Immunofluorescence Staining of Flag and GSK3β
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were grown on glass slides in 12-well plates, then fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100. After blocking, the cells were incubated with primary antibodies against Flag and GSK3β. Then Fluor 555 combined with goat anti-mouse secondary antibody (Invitrogen, Carlsbad, CA, USA) or Fluor 488 combined with goat anti-rabbit secondary antibody (Invitrogen) was used to detect fluorescence. The nuclei were stained with DAPI (Vector Laboratory, Cambridgeshire, UK). A representative image was collected using a Carl Zeiss LSM 510 laser scanning confocal microscope.
6
Immunofluorescence Staining of HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were washed twice with PBS, fixed and permeabilized with methanol-acetone (1:1, v/v) for 6.5 min at 4°C, and then washed three times with PBS. The cells were blocked for 30 min in PBS that contained 3% bovine serum albumin (BSA) and incubated with the respective primary antibody in blocking buffer for 2 hr at room temperature. After washing three times with PBS, the cells were incubated with the respective secondary antibody in blocking buffer for 1 hr at room temperature. After washing three times with PBS, the coverslips were mounted in SlowFade Gold antifade reagent (Invitrogen) and examined under oil immersion on a Zeiss LSM 510 laser scanning confocal microscope.
7
Quantification of Malaria Parasite Egress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We performed live-cell recording as described24 (link) using an LSM 510 laser-scanning microscope (Carl Zeiss AG, Oberkochen, Germany) with a 63 × 1.4 NA oil objective and 488-nm laser with low light intensity to minimize cell photodamage. To observe parasite egress, we isolated schizonts from culture using 65% Percoll64 (link),65 (link), adjusted them to 0.1–0.2% hematocrit in media of different compositions at 37 °C, and placed them into special environmental chambers for microscopy (HybriWell HBW20, Grace Bio-Labs, Inc., Bend, OR). These chambers preserve cell viability for several hours, as well as egress sites, i.e., places where schizonts ruptured and released merozoites at the end of their IDC24 (link). To quantify the effect of heparin on egress, we kept chambers at 37 °C for 60–90 minutes to accumulate egress sites, and then cooled them at 15 °C for 30 minutes to stop egress. We quantified egress as the fraction of schizonts releasing merozoites.
8
Visualizing mCherry-FXYD5 and Actin in mATII Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolated mATII cells were plated on glass-bottom dishes (MatTek corporation), fixed by incubation with 3.75% formaldehyde in PBS for 15 min at 37°C, and actin filaments were visualized using fluorescein phalloidin (Thermo Fisher Scientific) as described previously (53 (link)). Confocal microscopy images of mCherry-tagged FXYD5 and stained actin filaments were acquired using a Zeiss LSM 510 laser scanning confocal microscope and ZEN 2009 software (Carl Zeiss MicroImaging GmbH).
9
Confocal Imaging of Calcium Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Confocal microscopy of separate optical sections was acquired using an LSM 510 laser scanning confocal microscope (Carl Zeiss, Jena, Germany), equipped with a 20 × water immersion objective (Zeiss W Plan-Apochromat 20 × /1,0 DIC VIS-IR, Carl Zeiss, Jena, Germany). The calcium-sensitive dye was excited with a 488 nm wavelength laser, and emitted light was filtered through a 500-550 nm band-pass filter. Optical sections were acquired at 1 Hz in two different depths (~ 35 μm, and 140 μm from the surface of the AL), with a resolution of 0.77 μm/px (x, y), and a full-width half maximum of 25 μm (z).
10
Motor Neuron Nuclear TDP-43 Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two sections each of the brain, spinal cord, and muscle sections were analyzed for each of the 6 animals of each genotype. Motor neurons were identified by their location in the cortex and ventral horn, as large nucleus, prominent nucleolus, polygonal shapes, and relatively large sizes. Only cells with clearly visible nucleolus were chosen for analysis. Images were captured using a Zeiss LSM 510 laser scanning microscope with a 63x oil immersion objective and 2x digital zoom. Image analysis was performed using ImageJ software (NIH). To quantify nuclear TDP-43, images of motor neuron nuclei were displayed in ImageJ with automatic setting of brightness and contrast. All distinct speckles of nuclear TDP-43 fluorescence with a minimum diameter of 1 μm were then counted manually using the point picker function. Cajal bodies and TDP-43 speckles were counted blind to genotype.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!