LDH-A: Forward (GGATCTCCAACATGGCAGCCTT), Reverse (AGACGGCTTTCTCCCTCTTGCT); and β-actin: Forward (CACCATTGGCAATGAGCGGTTC), Reverse (AGGTCTTTGCGGATGTCCACGT).
Rt reagent kit
The RT Reagent Kit is a set of reagents designed for reverse transcription (RT) reactions. The kit includes the necessary components for converting RNA into complementary DNA (cDNA) that can be used in downstream applications such as qPCR or gene expression analysis. The core function of the RT Reagent Kit is to facilitate the reverse transcription process.
Lab products found in correlation
24 protocols using rt reagent kit
Quantifying LDH-A and miR-7 Expression
LDH-A: Forward (GGATCTCCAACATGGCAGCCTT), Reverse (AGACGGCTTTCTCCCTCTTGCT); and β-actin: Forward (CACCATTGGCAATGAGCGGTTC), Reverse (AGGTCTTTGCGGATGTCCACGT).
Total RNA Extraction and qRT-PCR Analysis
Analyzing Gene Expression in Colon Cancer Cells
RNA Extraction and qPCR Analysis
Quantitative Real-Time RT-PCR for miR-30e
Quantification of miR-7 Expression
Quantitative Analysis of miR-22 and Twist1
Quantifying circSMO742 and miR-338-3p in Glioma
Quantitative Analysis of miRNA and mRNA Expression
Bacterial RNA Extraction and qPCR Analysis
In a fluorescent quantitative PCR (q-PCR) system, 10 μL of ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Nanjing Co., Ltd., Nanjing, China), 1.6 μL of diluted cDNA, 0.4 μL of each primer, and 7.6 μL of nuclease-free water were used in a 20 μL reaction. The reaction protocol consisted of 2 min at 95 °C, 40 cycles of 10 s at 95 °C, and 30 s at 60 °C. Every sample was examined three times. The 2−ΔΔCT technique was used to determine the relative expression of genes; the 16S gene was chosen as a standardized internal reference. The virulence factor primers related to the phenotype experiments were designed according to the complete genome data of V. mimicus SCCF01 available in our laboratory. Primers are listed in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!