Log In Sign up
The largest database of trusted experimental protocols

Nucleofector technology

Manufactured by Lonza
Visit Supplier
Sourced in United States, Switzerland, Germany

The Nucleofector Technology is a laboratory equipment solution designed for the efficient intracellular delivery of nucleic acids, such as DNA, RNA, or protein, into a variety of cell types. The technology utilizes a specialized electroporation-based method to facilitate the transfection of these molecules into the target cells.

Automatically generated - may contain errors

Lab products found in correlation

Amaxa cell line nucleofector kit 5, by Lonza (3 mentions) Pegfp n1 vector, by Takara Bio (3 mentions) Stealth sirna probes, by Thermo Fisher Scientific (2 mentions) Lipofectamine ltx, by Thermo Fisher Scientific (2 mentions) Nucleofector 2b device, by Lonza (2 mentions) Rnaimax, by Thermo Fisher Scientific (2 mentions) Hiperfect, by Qiagen (2 mentions) Dead cell removal kit, by Miltenyi Biotec (2 mentions) Geneart seamless cloning technology, by Thermo Fisher Scientific (2 mentions) Quikchange 2 xl site directed mutagenesis kit, by Agilent Technologies (2 mentions) Compozr targeted integration kit aavs1, by Merck Group (1 mentions) Nucleofector solution, by Lonza (1 mentions) Secrete pair dual luminescence assay kit, by GeneCopoeia (1 mentions) Cd3 microbeads, by Miltenyi Biotec (1 mentions) Sirna3, by Thermo Fisher Scientific (1 mentions) Lipofectamine, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Nucleofector device, by Lonza (1 mentions) Cd3 pe, by Beckman Coulter (1 mentions) Facscanto flow cytometer, by BD (1 mentions)

56 protocols using nucleofector technology

1

GFAP-eGFP Knock-in in iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Enhanced green fluorescent protein (eGFP) and SV40 polyA sequence was cloned from pEGFP-N2 plasmid with some modifications. The Not I site between eGFP and SV40 polyA sequence was nulled and subsequently flanked by ClaI and NotI. This was followed by the cloning and ligation of a 7.5 kb promoter region of the human GFAP gene with eGFP and SV40 polyA sequence using EcoRI and ClaI sites. This cassette was then inserted into the targeting vector pZDonor –AAVS1 puromycin using EcoRI and NotI sites, flanked by 500bp left arm and 500 bp right arm for homologous recombination. The targeting vector total length reached about 16kb.
The integration of the targeting vector into iPSCs was performed following the manufacturer’s protocol of the CompoZr Targeted integration-AAVS1 kit (Sigma-Aldrich). Briefly, 5 million iPSCs were transduced with 30µg targeting vector and 5µl ZFN mRNA using Nucleofector technology (Amaxa). Cells were treated with 2–5µg/ml puromycin for 12 days. Individual positive clones were picked using sterile pipette tips and transferred to 96-well plates for further identification. Puromycin-resistant clones were confirmed by PCR and Southern blotting (see also Figure 1a–c).
Zhang P.W., Haidet-Phillips A.M., Pham J.T., Lee Y., Huo Y., Tienari P.J., Maragakis N.J., Sattler R, & Rothstein J.D. (2015). Generation of GFAP::GFP astrocyte reporter lines from human adult fibroblast-derived iPS cells using zinc-finger nuclease technology. Glia, 64(1), 63-75.
+ Open protocol
+ Expand
2

Podocyte Transient Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Podocytes were transiently transfected with the Nucleofector technology (Amaxa Biosystems), which used electroporation for gene transfer. Transfection efficiency was determined by transfecting podocytes with a vector (pMaxGFP) encoding the green fluorescent protein (GFP) and counting the percentage of GFP-positive cells. We tested several protocols based on the manufacturer’s instructions. After optimization, we achieved 80 to 90% transfection efficiency with Amaxa’s Nucleofector solution and Program T-20. Complementary DNA (1 μg/ml) was used for transfections. Wild-type PTP-SL and PTP-SL-S231A mutant vectors were obtained from R. Pulido. Expression of the transfected proteins was verified by immunoblot.
Azeloglu E.U., Hardy S.V., Eungdamrong N.J., Chen Y., Jayaraman G., Chuang P.Y., Fang W., Xiong H., Neves S.R., Jain M.R., Li H., Ma’ayan A., Gordon R.E., He J.C, & Iyengar R. (2014). Interconnected Network Motifs Control Podocyte Morphology and Kidney Function. Science signaling, 7(311), ra12.
+ Open protocol
+ Expand
3

Nucleofection of Human MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nucleofector technology (AMAXA Biosystems) was used to perform transfection, which was based on electroporation with each nucleofection sample containing 2–4 μg of DNA, 4 × 105 cells, and 100 μl of Human MSC Nucleofector Solution. We used the program C-17 of the Nucleofector device to carry out the transfection as recommended by the manufacturer.
Lin S.P., Chiu F.Y., Wang Y., Yen M.L., Kao S.Y, & Hung S.C. (2014). RB Maintains Quiescence and Prevents Premature Senescence through Upregulation of DNMT1 in Mesenchymal Stromal Cells. Stem Cell Reports, 3(6), 975-986.
+ Open protocol
+ Expand
4

Efficient siRNA and Plasmid Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Silencer predesigned siRNA targeting IL-1α (ID:s7266) or Silencer™ Negative Control#1 siRNA (ID:4390843) used in knockdown experiments were obtained from Ambion. Plasmid encoding full-length IL-1α pCMV6-IL-1α (SC324639) and the control empty vector pCMV6-AC (PS100020) were purchased from Origene Technologies (Rockville, MD). siRNA and plasmids were transfected using Nucleofector™ technology (Amaxa Inc) with the “Amaxa Cell Line Nucleofector kit V” according to the manufacturer's recommendations [32 (link)]. Briefly, 3-5 × 106 log phase cells were suspended in 100 μL of Nucleofector Solution V, mixed with 3 μg of siRNA or plasmid DNA, and electroporated with the program X-001. After electroporation, cells were suspended in 500 μL of pre-warmed cell culture medium and seeded in complete medium for 6 h after which the medium was changed to serum-free medium containing 0.5% BSA. Gene knockdown and overexpression was verified measuring IL-1α in the cell culture supernatants by ELISA.
León X., Bothe C., García J., Parreño M., Alcolea S., Quer M., Vila L, & Camacho M. (2015). Expression of IL-1α correlates with distant metastasis in patients with head and neck squamous cell carcinoma. Oncotarget, 6(35), 37398-37409.
+ Open protocol
+ Expand
5

Silencing MyD88 in Primary Human CMFs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary human CMFs lacking MyD88 expression were generated in our lab using Stealth™ siRNA probes (Invitrogen, CA). Negative siRNA controls with appropriate GC content were included in each experiment. An optimal concentration of each siRNA (0.3 nM) was used for each transfection. Transfection of primary cells was performed using Nucleofector™ technology (Amaxa Biosystems, MD, USA) according to the manufacturer’s instructions.
Uribe G., Villéger R., Bressollier P., Dillard R.N., Worthley D.L., Wang T.C., Powell D.W., Urdaci M.C, & Pinchuk I.V. (2018). Lactobacillus rhamnosus GG increases COX 2 expression and PGE2 secretion in colonic myofibroblasts via a MyD88 dependent mechanism during homeostasis. Cellular microbiology, 20(11), e12871.
+ Open protocol
+ Expand
6

Luciferase Assay for Collagen XVII Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
Luciferase assay was performed using the Secrete-Pair Dual Luminescence Assay kit according to the manufacturer's protocol (GeneCopoeia, Rockville, MD). All transfections were performed using nucleofector technology (AMAXA Biosystems, Cologne, Germany) according to the manufacturer's instruction. WT and mutated Col17a1 promoters were cloned in pEZX-PG04 reporter plasmid (GeneCopoeia).
Liu C.C., Lin S.P., Hsu H.S., Yang S.H., Lin C.H., Yang M.H., Hung M.C, & Hung S.C. (2016). Suspension survival mediated by PP2A-STAT3-Col XVII determines tumour initiation and metastasis in cancer stem cells. Nature Communications, 7, 11798.
+ Open protocol
+ Expand
7

Human CD3+ T-cell Isolation and Stimulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human CD3+ T-cells were sorted from peripheral blood mononuclear cells (PBMCs) that were obtained from one healthy donor from our team by positive selection using CD3 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). The study was approved by the ethics committee of The First Affiliated Hospital of Jinan University. The donor was informed about this study, and written informed consent was signed. The purified CD3+ T-cells were cultured in complete medium, which was supplemented with 200 IU/mL of IL-2 and 2 μg/mL of PHA and maintained in a 95% humidified incubator at 37°C and 5% CO2 for 6 days after stimulation and used for siRNA transduction using Nucleofector™ technology (Amaxa Biosystems, Cologne, Germany).5 (link)
Wang X., Lu S., Xiao Y., Xu L., Zhou L., Hu J., Li B., Zeng C, & Li Y. (2018). Alteration of gene expression profile in CD3+ T-cells after downregulating MALT1. ImmunoTargets and Therapy, 7, 77-81.
+ Open protocol
+ Expand
8

Generating Stable A7r5 Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
A7r5 aortic SMC were transfected using the Nucleofector technology (Amaxa) according to the manufacturer’s instructions. To generate stable cell lines, A7r5 were cultured in DMEM– F/12 growth medium supplemented with 400μmol/L G418 (Sigma) for 10 days. G418-resistant cells were propagated and maintained in G418 (400μmol/L) selection medium. Passages 3-15 were used in experimental studies.
Zhong W., Oguljahan B., Xiao Y., Nelson J., Hernandez L., Garcia-Barrio M, & Francis S.C. (2014). Serum and Glucocorticoid-Regulated Kinase 1 Promotes Vascular Smooth Muscle Cell Proliferation via Regulation of β-catenin Dynamics. Cellular signalling, 26(12), 2765-2772.
+ Open protocol
+ Expand
9

Silencing Human Cath-D and TRPS1 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
21-nucleotide siRNA duplexes against human Cath-D (target sequence AAGCUGGUGGACCAGAACAUC; siRNA1 [14 (link)]) were synthesized by Dharmacon RNA Technologies (Thermo Fisher Scientific Inc., Rockford, IL, USA), and the siRNA against firefly luciferase (Luc) (target sequence AACGUACGCGGAAUACUUCGA) by Qiagen Sciences (Maryland, USA). Human Cath-D siRNA2 (ID 105581) and siRNA3 (ID 4180) were purchased from Ambion (Austin, TX). Human TRPS1 siRNAs were purchased from Thermo Scientific Dharmacon (ON-TARGET plus: siRNA1 (J-009644–05), siRNA2 (J-009644–06), siRNA3 (J-009644–08)). T47D cells grown in 6-well plates were transiently transfected with Luc, Cath-D, or/and TRPS1 siRNAs using Lipofectamine (Invitrogen, Life Technologies, USA) by incubation at 37°C for 48 h. Cells were then lysed in 50 mM Hepes [pH 7.5], 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2 1 mM EGTA and a protease inhibitor cocktail. Total RNA was extracted from the lysates using the RNeasy Mini Kit (Qiagen Sciences, Maryland). T47D cells were also transfected with 1 μg Luc, Cath-D, and/or TRPS1 shRNA expression vectors (Invivogen, San Diego, CA, USA) using Nucleofector Technology (Amaxa biosystems, MD, USA). Sequences are shown in Table S7.
Bach A.S., Derocq D., Laurent-Matha V., Montcourrier P., Salwa Sebti S., Orsetti B., Theillet C., Gongora C., Pattingre S., Ibing E., Roger P., Linares L.K., Reinheckel T., Meurice G., Kaiser F.J., Gespach C, & Liaudet-Coopman E. (2015). Nuclear cathepsin D enhances TRPS1 transcriptional repressor function to regulate cell cycle progression and transformation in human breast cancer cells. Oncotarget, 6(29), 28084-28103.
+ Open protocol
+ Expand
10

Overexpression of PTEN in Human MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Overexpression plasmid, pcDNA6-PTEN (PTEN O/E), was generated by inserting a 2357-bp fragment of the full-length human PTEN cDNA from pOBT7-PTEN (Open Biosystems, Huntsville, AL) into the EcoRI/XhoI sites of the pcDNA6TMV5-HisA vector (Invitrogen). Transfection was carried out by Nucleofector technology (AMAXA Biosystems, Cologne, Germany) with each nucleofection sample containing 2–4 μg of DNA, 4 × 105 cells, and 100 μl of Human MSC Nucleofector Solution using the program C-17 of the Nucleofector device, as recommended by the manufacturer.
Shen W.C., Lai Y.C., Li L.H., Liao K., Lai H.C., Kao S.Y., Wang J., Chuong C.M, & Hung S.C. (2019). Methylation and PTEN activation in dental pulp mesenchymal stem cells promotes osteogenesis and reduces oncogenesis. Nature Communications, 10, 2226.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!