Megabace 1000

The sequencing reaction was performed using 500 ng of DNA for each selected phage clone, 5 pmol primer 96 gIII (5′-OH CC TCA TAG TTA GCG TAA CG-3′, Biolabs), plus a pre-mix (Dye Terminator Cycle ET Journal Kit, Amersham Biosciences). Thirty-five cycles were performed in a thermocycler, under the following conditions: denaturation at 95°C for 20 sec, ringing at 58°C for 15 sec, and extension at 60°C for 60 sec. Ten microliters of the generated amplicons were precipitated with 1 µL of ammonium acetate (1∶10 ratio), added with 27.5 µL of ethanol PA. The plate was centrifuged for 45 min to 2,432×g, when the supernatant was discarded and 150 µL of 70% ethanol was added to the pellet. The resuspended DNA was centrifuged for 10 min at 2,432×g, and the supernatant was discarded again. The plate was inverted on a paper towel and, in this position, was centrifuged at 486×g for 1 min. Next, the plate was covered for 5 min, until the complete evaporation of the remaining ethanol had been achieved. The pellet was resuspended in dilution buffer, and the sequencing was performed in a MegaBace 1000 automatic sequencer (Amersham Biosciences). Peptide sequences of 20 valid phage clones were deduced using the Expasy server (www.expasy.org), and analyzed with the Pepbank [38] (link), MimoDB [39] (link) and SAROTUP [40] (link) programs to identify possible false-positive sequences.

The internal transcribed spacer 2 (ITS2) part of the nuclear ribosomal DNA was amplified with the primer pair ITS2/ITS4 according to White, Bruns, Lee and Taylor (1990) on a PTC-225 (Peltier Thermal Cycler, MJ Research, Waltham, MA, USA). PCR amplicons were purified with ExoSap IT (GE healthcare, Buckinghamshire, UK) according to the manufacturer’s procedure and visualized on standard agarose gel to ensure the presence of single-band products. Both strands of the PCR amplicons were sequenced with the PCR primers using DYEnamic ET dye terminator chemistry (Amersham Biosciences, Chicago, IL, USA), purified on AutoSeq96 (Amersham Biosciences) plates, diluted with 10 µL of MQ-water and subsequently analyzed on a MegaBace 1000 (Amersham Biosciences). Sequences were analyzed in Vector NTI Advanced 11 (Invitrogen, Waltham, MA, USA) and assembled in BioEdit 7.0.9.0 [29 ].

We extracted total genomic DNA using a modified cetyltrimethyl ammonium bromide (CTAB) protocol (Rogers and Bendich, 1988 (link)) or DNA secure Plant Kit (Tiangen). We used the DNA extractions to isolate two mtDNA fragments, nad1 intron 2 and nad5 intron 4, and one cpDNA intergenic spacer, trnS/G, following procedures in Shao and Xiang (2015 (link)). We performed sequencing reactions using a DYEnamic ET Terminator Kit (Amersham Pharmacia Biotech), and detected labeled sequencing products on a MegaBACE 1000 (Amersham Biosciences, Buckinghamshire, UK). We deposited all newly generated sequences in GenBank under accession numbers KP635976–KP636041.

One hundred and ten isolates were identified by molecular biological methods. Aspergillus spp. with black pigmentation (N = 13) were identified by microculture test [17 ] due to difficulties in DNA extraction and PCR amplification.
Filamentous fungi were grown on Sabouraud agar for seven days, and DNA was extracted according to the method of Rosa et al. [20 ]. The ITS region of rDNA was amplified from the extracted DNA by polymerase chain reaction (PCR) using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC), according to the method of White et al. [21 ]. The amplified product was quantified with a NanoDrop 1000ND (NanoDrop Technologies), and the concentration was adjusted to 100 ng μL^-1 for use in sequencing reactions.
Sequencing was performed with DYEnamic (Amersham Biosciences, USA) in a MegaBACE 1000 automated sequencing system at the Genome Analysis Center and Gene Expression of UFMG. The obtained DNA sequences were analyzed using BLASTn (v.2.215) of BLAST 2.0 at the NCBI website [22 ]. Isolates with ≥99% sequence similarity to deposited sequences were considered the same species.

The 930 bp amplified fragments corresponding to sat of EAEC CV323/77 and DEC/Sat⁺ strains were sequenced in a Mega-BACE 1000 (Amersham Pharmacia Biotech) sequencer. Reactions were performed according to the manufacturer’s instructions, using the APBiotech DYEnamic ET Dye Terminator Cycle Sequencing Kit. Sequence analysis was performed using the MEGA Version 7.0.26 software (Analysis Expert DNA Star Software, Inc. PC, Madson, WI, USA) and BioEdit Sequence Alignment Editor 7.0.5.3 (Carlsbad). The identity of the nucleotide sequence of the 930 bp fragment of both strains with CFT073 (GenBank accession number AF289092.1) was searched using the BLASTn program.

Total DNA was isolated from buccal or blood samples using the POREGENE DNA isolation kit from Gentra Systems (Minneapolis, USA). The mtDNA hypervariable regions I and II of the U3 samples were amplified and sequenced for both complementary strands as detailed elsewhere [31 (link)]. When necessary for unequivocal assortment into specific subclades, the U3 samples were additionally analyzed for haplogroup diagnostic SNPs using partial sequencing of the mtDNA fragments including those SNPs, or typed by Snapshot multiplex reactions [32 (link)]. For mtDNA genome sequencing, amplification primers and PCR conditions were as previously published [20 (link)]. Successfully amplified products were sequenced for both complementary strands using the DYEnamic™ETDye terminator kit (Amersham Biosciences) and samples run on MegaBACE™ 1000 (Amersham Biosciences) according to the manufacturer’s protocol. The 57 new complete mtDNA sequences have been deposited in GenBank under accession numbers KY411439-KY411495 (Additional file 1: Table S3; Additional file 2: Figures S1 and S2).

The mtDNA hypervariable regions I and II of 1,725 new Saudi Arabian samples were amplified and sequenced as detailed elsewhere [20 (link)]. When necessary, haplogroup diagnostic SNPs were typed using PCR-RFLPs or SNaPshot multiplex reactions [21 (link)]. The 1,725 new partial mtDNA sequences have been deposited in GenBank under accession numbers KP960570-KP962294. In addition, complete mtDNA genome sequencing was carried out on 28 western Asian individuals of uncertain or atypical haplogroup adscription. These include the reanalysis of five samples belonging to haplogroup N(xR) previously published in Maca-Meyer et al. [17 (link)]. For mtDNA genome sequencing, amplification primers and PCR conditions were as previously published [17 (link)]. Successfully amplified products were sequenced for both complementary strands using the DYEnamic ET Dye terminator kit (Amersham Biosciences) and samples run on MegaBACE 1000 (Amersham Biosciences) according to the manufacturer's protocol. The 23 new complete mtDNA sequences have been deposited in GenBank under accession numbers KM245130-KM245152. The five sequences previously published [17 (link)] and reanalyzed here have kept their previous GenBank accession numbers (S3 Table).