Mesa green qpcr mastermix plus

qRT-PCR analyses were performed as described before (58 (link)). qRT-PCR experiments were performed with three independent biological replicates and two technical replicates each (if not stated otherwise) using the MESA Green qPCR Mastermix Plus (Eurogentec). qRT-PCR was performed using the CFX Connect real-time PCR detection system and analyzed with the CFX Manager Maestro software (Bio-Rad).

THP1 cells were infected with M. tuberculosis H37Rv as described above at an MOI of 10:1 for 4 hrs followed by treatment with gentamycin for 2 hrs. Cells were harvested at 0 hrs, 24 hrs and 48 hrs of infection and DNA-RNA were isolated using Qiagen All Prep Kit. 1 μg of RNA was converted to cDNA using SuperscriptIII (Invitogen). The change in expression upon infection of M. tuberculosis H37Rv in THP1 cells was evaluated by Real Time PCR using Mesa Green qPCR Mastermix Plus (Eurogentec) in ABI Prism SDS 7500 system. GAPDH was used as internal control. C_t values were normalized for GAPDH and fold change in infected sample with respect to uninfected samples was plotted.

One μg of total RNA was used to generate the cDNA, using the M-MLV reverse transcriptase (Life Technologies) and random hexamer primers, following the manufacturer's instruction. Quantitative real-time PCR (RT-qPCR) was performed in triplicate for each sample (20 HCC, 20 adjacent non tumour tissues and 10 control livers). The genes tested were FAM99A, LINC01093, CRNDE, H19 and HULC. SFRS4 was used as a reference gene, as it is reported to be very stable in liver disease context [50 (link)]. Moreover SFRS4 is also expressed at similar levels in both tissue types in each of the pairs we analysed (data not shown). The primers used are reported in Table 5. The assays were performed using MESA GREEN qPCR MasterMix Plus (Eurogentec) and a CFX96 Real-Time PCR Detection System (Biorad). mRNA levels were calculated using the 2^−ΔCt method (ΔCt = ΔCt ^{target gene}-ΔCt ^{reference gene}).

CAFs were trypsinized and cell pellets were washed twice with RNase-free water. RNA was isolated with the miRNeasy kit (Qiagen, Venlo, The Netherlands), cDNA synthesis was performed with the iScript cDNA synthesis kit (Bio-Rad), and RT-qPCR analysis was performed on the MyiQ RT-PCR detection system (Bio-Rad) by using Mesa Green qPCR MasterMix Plus (Eurogentec, Seraing, Belgium), in accordance with the manufacturer's instructions. A preliminary experiment was conducted to identify three appropriate reference genes (TBP, YWHAZ, GAPDH) out of a set of ten genes by using qBASE+ software (Biogazelle, Zwijnaarde, Belgium). Primers (Biolegio, Nijmegen, The Netherlands) are displayed in Table 1. All primers were blasted in Primer Blast (NCBI).

tva +/+, tva +/−, and tva −/− chickens at the age of 23 to 39 days were infected by i.v. injection of 10⁶ IU of either RCASBP(A)GFP or RCASBP(K)GFP [12 (link),16 (link),32 (link)]. Nine and 13 d p.i., blood samples were collected, and sera were prepared. QIAamp Viral RNA Mini Kit (Qiagen) was used for virus RNA isolation from the chicken sera, according to the manufacturer’s protocol. Five microliters of prepared RNA was reversely transcribed with Protoscript II Reverse Transcriptase (NEB) and 3′CDS primer (5′AAGCAGTGGTATCAACGCAGAGTACT₃₀VN3′). An amount of 1.5 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for RCAS-A-env (Forward 5′GGGATGCGTAGGCTTCAGA3′, Reverse 5′AAAATCTGTAGCCATATGCACCG3′) or RCAS-K-env (Forward 5′GCCCCCGGAGCATTGACAA3´, Reverse 5′GGACCTGTCTGTGAACAATTATATAGC3′). To generate the standard curve for absolute quantification of gene expression, we used serial dilution of RCASBP-A and RCASBP-K plasmids. The samples were run in a Bio-Rad CFX96^TM Real-Time instrument with a 3-step protocol: one cycle of 8 min at 95 °C, then 40 cycles of 15 s at 95 °C, 25 s at 60 °C, and 35 s at 72 °C and final polymerization at 72 °C for 10 min. Cycles of quantification (Cq) values were generated by the CFX Manager software. The specificity of the PCR product was confirmed by melting curve analysis.

In order to quantify gene transcripts, total RNA was isolated using Tri Reagent (Sigma-Aldrich) following the manufacturer’s instructions. Complementary DNA (cDNA) was generated by reverse transcription of RNA using M-MLV reverse transcriptase (Promega) and was quantified by real-time PCR using Mesa Green qPCR MasterMix plus (Eurogentec). Riboprotein L19 was used as internal normalization control. FCs were calculated using the comparative Ct method (∆∆Ct). Primers used for quantitative RT-PCR are listed in Supplementary Table 4.
For quantitative miRNA analysis, total RNA was isolated using miRNeasy kit (Qiagen). Mature miRNAs were reverse-transcripted by using the miRCURY LNA Universal RT miRNA PCR kit (Exiqon). MiR-1199-5p (Exiqon; 206004) expression was measured by RT-PCR and normalized to U6 small nuclear RNA (Exiqon; 203907) expression as internal control. FCs in miRNA expression were calculated using the comparative Ct method (∆∆Ct).