To detect 5mC and 5hmC levels, genomic DNA was extracted by phenol-chloroform-isoamyl alcohol, and the concentration of samples was serially diluted twofold. Dot blot analysis was performed as described previously [5 (link)]. Subsequently, genomic DNA was spotted on a positively charged nylon membrane (Roth, Karlsruhe, Germany), air dried for 15 min and cross-linked using the UV light (20 s, 1,200 J/cm2). Then membranes were blocked in 5% non-fat milk in PBS/0.1% Tween-20 for 1 h at RT before incubation incubated with anti-5mC (1:5,000; Abcam, UK) antibody or anti-5hmC (1:5,000; Active Motif, Carlsbad, CA, USA) overnight at 4°C followed by washing in PBS for 3 times. The membrane was then incubated with HRP-labeled anti-mouse/rabbit secondary antibody (1:5,000; Santa Cruz, USA) and signal was developed using an enhanced chemiluminescence reagent (Bio-Rad, USA). The intensity of signal was measured using Image J software and calibrated against the linear range of the standard curves to estimate the quantities of 5mC or 5hmC in each sample.
Positively charged nylon membrane
Manufactured by Carl Roth
Sourced in Germany
Positively charged nylon membrane is a type of laboratory equipment used for various applications. It is made of nylon material and has a positive charge, which allows it to effectively capture and retain negatively charged molecules, such as nucleic acids. The membrane's primary function is to serve as a filtration and separation tool in various analytical and preparative techniques.
Automatically generated - may contain errors
Lab products found in correlation
Chemidoc imaging system, by Bio-Rad (2 mentions)
Enhanced chemiluminescence reagent, by Bio-Rad (1 mentions)
Anti 5mc, by Abcam (1 mentions)
Anti 5hmc, by Active Motif (1 mentions)
α 32p datp, by Hartmann Analytic (1 mentions)
Decalabel dna labeling kit, by Thermo Fisher Scientific (1 mentions)
Xbai, by New England Biolabs (1 mentions)
Methylene blue, by Merck Group (1 mentions)
Nucleospin gel and pcr clean up kit, by Macherey-Nagel (1 mentions)
Dig high prime dna labeling and detection starter kit 2, by Roche (1 mentions)
Spectrum plant total rna kit, by Merck Group (1 mentions)
Dig easy hyb granules buffer, by Roche (1 mentions)
Pcr dig probe synthesis kit, by Roche (1 mentions)
6 protocols using positively charged nylon membrane
1
Quantifying 5mC and 5hmC DNA Modifications
2
Southern Blot Analysis of Transgenic Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA prepared from suspension‐cultured cells was digested with XbaI, BamHI/SpeI, or SacI (NEB) and separated on a 0.6% (small donors) or 0.4% (large donors) (w/v) agarose gel at 60 V for 3 hr. Prior to transfer, the DNA was depurinated by incubating the gels in 0.25 M HCl for 15 min. The DNA was subsequently denatured by incubation in 0.5 M NaOH and 0.5 M NaOH/1.5 M NaCl for 30 min each. After neutralization (1 M Tris, 1.5 M NaCl, pH 7.0) for 30 min, the DNA was transferred to a positively charged nylon membrane (Carl Roth) by vacuum transfer with the Vacu‐Blot device according to the manufacturer's instructions (Biometra, Göttingen, Germany) using 2 × SSC. The DNA was immobilized on the membrane by incubation at 80°C for 2 hr. Probes were labeled using α32P‐dATP (Hartmann Analytic) and the DecaLabel DNA labeling kit (Thermo Fisher Scientific). Hybridization was performed using the Roti‐Hybri‐Quick solution (Carl Roth) according to the manufacturer's instructions. For probe preparation, the following regions were PCR amplified from pDAB113628: 48‐1041 (3′ end of target T‐DNA), 8455‐9491 (5′ end of target T‐DNA), and 9044‐9784 (TR intron). Region 2181‐2891 was PCR amplified from pDAB113676 to prepare the DsRed_5′probe.
3
Quantification of DNA Methylation Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purity of DNA was verified using NanoDrop 260/280 ratio and agarose gel electrophoresis. DNA was diluted in H2O to 200 ng, 100 ng and 50 ng in 200 µl per slot. Slot-Blotter device (Carl Roth GmbH + Co KG, Karlsruhe, Germany) was assembled as according to the manual. DNA was blotted onto a positively charged nylon membrane (Carl Roth GmbH + Co KG, Karlsruhe, Germany) using vacuum application. Three identical membranes were prepared. The membranes were air-dried for 15—20 min and UV-crosslinked (20 s (s), 1200 mJ/cm2). One membrane was stained with methylene blue (0.02% methylene blue (Merck Millipore, Darmstadt, Germany) in 0.3 M sodium acetate (pH 5.2)) to validate DNA loading across the samples. The remaining two membranes were blocked in 5% milk powder in PBST for 1 h at RT. Membranes were incubated with 5mC or 5hmC antibody overnight at 4 °C. After washing, membranes were incubated with secondary antibody for 2 h at RT. Signals were detected using the ChemiDoc Imaging Systems (Bio-Rad Laboratories, Feldkirchen, Germany). See Additional file 12 : Table S2 D for antibody details.
4
DNA Methylation Dot Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA dot blots for comparison of DNA methylation levels were performed as described and repeated twice [39 (link)]. Briefly, for each dot, 5 µL of a 1 : 2 dilution series of DNA (ranging from 500 to 62.5 ng diluted in H2O) was spotted onto a positively charged nylon membrane (Carl Roth GmbH + Co KG, Karlsruhe, Germany) and air‐dried for 15 min. Afterward, the membrane was UV‐cross‐linked (20 s, 1200 mJ·cm−2) and blocked in 5% milk powder in PBST for 1 h at RT. The membrane was incubated with 5mC antibody overnight at 4 °C and secondary antibody for 2 h at RT. Methylene blue‐stained membranes (0.04% methylene blue in 5 m sodium acetate) served as loading control. Signals were detected using the ChemiDoc Imaging Systems, and dot intensity was quantified using the ‘Image Lab’ software (both from Bio‐Rad). See Table S3 for antibody details.
5
Chloroplast DNA Analysis of Transgenic Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plant DNA was isolated by the CTAB procedure (Murray and Thompson, 1980 ) from wild‐type plants and transplastomic plant lines after three rounds of regeneration on spectinomycin‐containing medium. Ten microgram of plant DNA was digested with SmaI, separated by electrophoresis in a 1% agarose gel and transferred onto a positively charged nylon membrane (Carl Roth GmbH, Karlsruhe, Germany) by capillary action using the semi‐dry transfer method. The probe binding inside the trnA region was amplified from lettuce wild‐type DNA by PCR (primers 5′‐GGAGGTAGGATGGGCAGTTG‐3′ and 5′‐GGACTCGAACCGCTGACATC‐3′). The probe was purified by agarose gel electrophoresis, followed by extraction of the fragment of interest from excised gel slices with the NucleoSpin gel and PCR Clean‐up Kit (Machery‐Nagel, Düren, Germany). The probe was DIG labelled using the DIG‐High Prime DNA Labeling and Detection Starter Kit II (Roche, Basel, Switzerland), according to the manufacturer's instructions. After immobilization of the DNA to the membrane, hybridization with the corresponding DIG labelled‐probe and incubation of the membrane with the HRP conjugated anti‐DIG antibody, the chemiluminescence signal was detected by exposure to X‐ray film. One homoplastomic plant line per construct (S12‐PN‐EDIII‐1‐4 and S16‐PN‐EDIII‐1) was chosen for further analysis.
6
Quantifying Transgene Expression in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from frozen and ground plant tissue with the Spectrum TM Plant Total RNA Kit (Sigma, USA). RNA samples (5 lg total RNA) were electrophoresed in 1.5 % agarose gels containing 2 % formaldehyde in 19 MOPS buffer (20 mM MOPS, 1 mM EDTA, 5 mM NaOAc, pH 7) and blotted onto a positively charged nylon membrane (Carl Roth GmbH, Germany) by the capillary transfer method. Transcripts were detected with DNA probes binding inside the transgenes coding region. The den1 probe was amplified by PCR from plasmid pKP9-ediii-1 with primers 5 0 -GCTGAAACTCAA-CATGGAACTG-3 0 and 5 0 -ATGCTTTTTCACCAGCAC CT-3 0 , the den3 probe from plasmid pKP9-ediii-3 with primers 5 0 -TGAAGATGGACAAGGAAAAGC-3 0 and 5 0 -CTCCACCACCTCCTTTACCA-3 0 . The primers bind inside the coding sequences and result in a 223 bp long den1 probe and a 197 bp long den3 probe. Probes were labelled with DIG using the PCR DIG probe synthesis kit following the manufacturer's protocol (Roche, USA). Hybridizations were performed in DIG Easy Hyb Granules Buffer (Roche, USA) at 50 °C, and signals were detected by exposure to X-ray film.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!