Pglosensor 22f

To assess CXCR4-mediated inhibition of cAMP production, control and COMMD8- or COMMD3-deficient HEK293 cells were transfected with plasmids encoding Flag-tagged CXCR4 and a luciferase-based cAMP biosensor, GloSensor (pGloSensor-22F; Promega) at a 1:1 ratio. 24 h after transfection, cells were collected in DMEM containing 1% FBS and seeded at a density of 8 × 10⁴ cells per well in 96-well clear-bottom white plates (3610; Corning). After 24 h of culture, the medium was replaced with 100 µl HBSS containing 0.1% fatty acid–free BSA and 10 mM Hepes plus 2% GloSensor cAMP reagent (Promega), and the cells were incubated for 2 h in the dark at room temperature. 5 min after stimulation with CXCL12, cells were treated with forskolin (10 µM; Sigma-Aldrich) for 15 min. To measure cAMP production mediated by endogenous β₂AR, control and mutant HEK293 cells were transfected with pGloSensor-22F in 96-well clear-bottom white plates. After 24 h, the cells were equilibrated with 2% GloSensor cAMP reagent for 2 h as described above, and then stimulated with isoproterenol for 1 min. GloSensor luciferase activities were measured in triplicate with a GloMax microplate reader (Promega) in luminescence mode.

Gs22a cells are derived from HEK293 cells (ATCC CRL-1573) by stable transfection with the luciferase-based glosensor cAMP reporter plasmid pGlosensor-22F (Promega Corp.)^{28 (link)}. The cells were cultured in DMEM supplemented with fetal bovine serum (10%) in a humidified incubator containing 5% CO₂ and set at 37 °C, and seeded into 96- or six-well plates for transient DNA transfection and functional assays. The cells were transfected when the monolayers were 85–95% of confluency using Lipofectamine™ 2000 (ThermoFisher, Cat. No 11668019) and 100 ng of DNA per well for 96-well plates and 1000 ng of DNA per well for 6-well plates, except for DNA-titration studies, in which 150 ng of total DNA was used for 96-well plates (plate reader assays) and 2000 ng of total DNA was used for six-well plates (flow cytometry assays), with the total amounts of DNA being comprised of a quantity of receptor-expressing plasmid DNA ranging from 2 ng/well to 150 ng/well for 96-well plates, and from 60 ng/well to 2000 ng/well for six-well plates, and an appropriate quantity of pCDNA1 vector DNA such that the total amount of DNA was equal in all wells. Transfection mixtures were prepared in Opti-Mem™ (Gibco, Cat. No 31985070) and contained 3 μl of Lipofectamine™ 2000 per μg of DNA. Assays were performed 48 hours after transfection, and media was changed 2–4 h prior to assay.

The PRESTO-Tango library (Addgene kit no. 1000000068) was a gift from Bryan Roth (University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA) (47 (link)). Plasmids encoding for human GPCRs were constructed by subcloning the ORFs from PRESTO-Tango to remove the C-terminus reporter sequence. pGloSensor-22F was purchased from Promega. The plasmid for knocking out human OXGR1 was constructed by ligation of sgRNA sequences into pLentiCRISPRv2 (sgOXGR1-1: CGTGGGATTTCCAGGCAATG; sgOXGR1-2: CTAGACTATTTAGCAAATGC). All other plasmids were purchased from Addgene. The siRNA target G_q/11 (siGNAQ: GACACCGAGAATATCCGCTTT; siGNA11: GCTCAAGATCCTCTACAAGTA) and β-arrestins (siARRB1/2: AAACCTGCGCCTTCCGCTATG siARRB1: AAAGCCTTCTGCGCGGAGAAT; siARRB2: AAGGACCGCAAAGTGTTTGTG) was synthesized by GenePharma. Oxgr1^–/– mice were a gift of Gang Shu (South China Agricultural University, Guangzhou, China) (48 (link)). Irg1^–/– mice (JAX, stock no. 029340) were purchased from The Jackson Laboratory. All mice were on a C57BL/6J background.

Human embryonic kidney HEK 293 T cells were grown in Dulbecco’s modified Eagle medium supplemented with 10% (v/v) fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C under humidified conditions containing 5% (v/v) CO₂. The cells (1 × 10⁴ cells/well) were seeded in a 96-well white cell culture plate (Becton Dickinson Corp.). After 24 h, the cells were transfected using 0.5 μL of Lipofectamine 2000 (Life Technologies) with 0.3 μg of OR-expression plasmid and 0.1 μg of pGlosensor-22 F (Promega) encoding a cAMP-sensing luciferase-based reporter20 , 0.1 μg of G_αolf-expression plasmid, or 0.1 μg of RTP1S-expression plasmid. After 40 ~ 50 h, the endogenous level of luciferase activity was measured with a luminometer (GloMax-Multi; Promega) using the GloSensor cAMP assay (Promega), which was defined as the control luminescence value (L₀). Upon stimulation with odorant, the luciferase activity induced was defined as the luminescence of the sample (L). Finally, the maximum level of luminescence (L_max) was obtained by the addition of 100 μM forskolin. Each measurement was performed for at least 30 min. The odorant-dependent change in intracellular cAMP concentrations was expressed as [(L − L₀)/(L_max − L₀)] × 100.

HEK293-ΔGαi cells were transfected in suspension with Histamine 3 receptor (H3R) plasmid, pGlosensor-22F (#E2301, Promega) and either a Gα_i/O-NLuc donor plasmid (rescue), wild-type Gα_i-protein plasmid (PC) or Transfection carrier DNA (#E4881; Promega) (NC). Transfected cells were seeded at a density of 3 × 10⁴ cells/well in white 96-well plates with clear flat bottom (#CLS3610, Merck) pre-coated with 100 µg/mL poly-D-lysin (#2780, Merck). Cells were incubated for 48 h at 37 °C and 5% CO2, after which they were washed with CO₂-independent medium (#18045-054, Thermo Fisher Scientific) supplemented with 10% FBS. CO₂-independent medium/10% FBS supplemented with 300 µM 3-isobutyl-1-methylxanthine (#I7018, MERCK) and 2% GloSensor cAMP reagent (#E1291, Promega) was then added to the cells (100 µL/well). After 2 h of incubation at 37 °C, baseline luminescence was measured every 5 s for 30 s using the FLIPR Penta. Thereafter, 25 µL of 5X Histamine (final concentration of 1µM) was automatically added to the cell plate, and bioluminescence was monitored in real time every 5 s for 10 min. Next, 25 µL Forskolin (#F6886, Merck) was added at a final concentration of 5 µM, and bioluminescence was monitored in real time for 40 min every 5 s. Statistical analysis was accomplished with one-way ANOVA followed by Dunnett’s test.